Question

5.) Why would the mitochondrion go to all of the trouble of hanging on to genes that code for tRNA when it would easier to import the tRNA molecules from its host cell? Like mad stupid or what? 6.) In Introductory Biology (and Chemistry), you are typically taught 'RNA language', since there is no thymine, A pairs with U and C pairs with G. Name one area of RNA that contains thymine. 7.) What is the function of wobble? EC! 20 points! Complete the following tasks: Consider the following ss of DNA for a sequencing project - SCGCGCGCCATTCGTCGCGCGGGTGCGTATAACTGTACACATGCTTATTTCTTAGCG) -Design a F and R primer for the ds genomic DNA. -What temperature should you use for melting the DNA? Why? -Annotate the ssDNA (e.g. label characteristic motifs). -What direction would this gene be synthesized to turn it into a transcript?

Answer 1

Q-5) :

• A critical difference between cytoplasmic and mitochondrial tRNA is the absence of clover leaf structure in the later with a low melting temperature.
• Further, mitochondria genome is read differently than the cytoplasmic genome, i.e the decoding system differs from the universal genetic code by the use of AUA for Met, UGA for Trp, and AGR (R = A and G) for a stop signal.
• For the 13 proteins encoded by the mitochondria, hence, it needs its own set of 11 tRNAs that could the information of mitochondrial genome and could form stable interaction with the amino acids during its translation.
• MItochondrial translation can not use cytoplasmic tRNA owing to differences in code and interactions.

Q-6) :

• Generally RNA contains Uracil instead of Thymine so Adenine pairs with U instead of T in RNA. But exceptionally,
• tRNA have modified bases, one of which is Ribothymine (T) which is a thymine base attached to a ribose sugar molecule.
• This thymine is found in the T-loop structure of tRNA molecule, which here exclusively provides structural stability to the tRNA molecule.

Q-7) :

• The Wobble Hypothesis explains why multiple codons can code for a single amino acid.
• One tRNA molecule (with one amino acid attached) can recognise and bind to more than one codon, due to the less-precise base pairs that can arise between the 3rd base of the codon and the base at the 1st position on the anticodon.

                                                   Please Rate My Answer.....Thank......u......