(1)Heated to 94°C
(2)DNA is denatured
(3)Tempreature is lowered (after adding primers)
(4)Primers hybridize the template
(5)Heat stable DNA polymerase adds the nucleotide sequence to 3' end of the primer.
(6)Heated to 72°c
(7)After one round of PCR the number of double stranded DNA molecules is doubled.
THANK YOU!! Target Region Heated to 94°C DNA is denatured GGGCAACGTG CATCACTTTG Primers hybridize with template...
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
Below is a sequence of double-stranded DNA that will be used as a template in the polymerase chain reaction (PCR). The goal is to use this as a template to make a a PCR product that includes the shaded area. The sequence of one of the PCR primers is given below. Template DNA: 5' - CTTAGCGCTGTTGGGGGCCAACTATCACACACACCACACACAGGTATAAATGGCATTTGATACAGATTG - 3' 3' - GAATCTGTATCAAATGCCATTTATACCTGTGTGTGGTGTGTGTGATAGTTGGCCCCCAACAGCGCTAAG - 5' If the sequence of one of the primers is 5' TTGTGGGGCC 3' which of the following primers...
Please help me with these questions. Thank u very much. Q1: A DNA sample from an individual is analyzed. The population frequency of one of the STR alleles is 1 in 50, a second STR allele is 1 in 100, and a third STR allele is 1 in 30. What is the combined frequency of these three STR alleles? a.1 in 150,000 b.1 in 15,000 c.1 in 1,500 d.1 in 180 e.1 in 50 Q2: Which of the following hybridize...
1.The PCR (polymerase chain reaction) protocol that is currently used in laboratories was facilitated by the discovery of a bacterium called Thermus aquaticus in a hot spring inside Yellowstone National Park, in Wyoming. This organism contains a heat-stable form of DNA polymerase known as Taq polymerase, which continues to function even after it has been heated to 95°C. a.Why would such a heat-stable polymerase be beneficial in PCR? b.What would happen if it weren’t heat stable? c.How might you choose...
.Select the probe sequence that will hybridize to the following nucleic acid sequence: C G A T A T T G T C A. T A G T A C A A G A B. C G A T A T T G T C C. G T C A A G A C C T D G C T A T A A C A G Select the strand of RNA that is complementary to this single strand of...
24. What would be the anticodon if the template strand of DNA Is ACC A UCC B.) TGG UGG D. ACC E. TCC 25. Prior to protein synthesis, the DNA A. attracts tRNAs with appropriate amino acids. 6.) serves as a template for the production of mRNA. C. adheres to ribosomes for protein synthesis. D. contains anticodons that become codons. E. must first undergo replication. 26. The Human Genome Project has revealed that human DNA has approximately A. 30,000 bases...
QUESTION 1: You are inserting a gene into an MCS found within the LacZ gene. Using blue/white colony selection, why could you assume that white colonies have modified plasmids? a. A blue colony means the LacZ reading-frame was disrupted b. A blue colony means your gene has mutations c. A white colony means the LacZ reading-frame is intact d. A white colony means the LacZ reading-frame was disrupted QUESTION 2: You are performing a PCR using primers with a sequence perfectly...
CELL BIOLOGY PLSS HELP!! I don't know if selected answers are correct so pls tell me the answer > A Moving to another question will save this response. Question 25 Pluripotent stem cells are typically derived from the: A. Trophoectoderm B. Endoderm C. Placenta OD. Inner cell mass (ICM) of a blastocyst E. Zygote A Moving to another question will save this response, > A Moving to another question will save this response. Question 24 What is always the first...
1. Describe the functions of the following reagents in extraction of DNA from corn meal: proteinase K; guanidine HCI; SDS 2. Why is the ratio of the OD at 260 and 280 nm used to estimate DNA purity? 3. In one paragraph, summarize basic principles of PCR technique in your own words. List all the reagents you will need to perform a PCR experiment. Does this method tell you what genetic modifications were made? If yes, describe how you can...