Question

Target Region Heated to 94°C DNA is denatured GGGCAACGTG CATCACTTTG Primers hybridize with template Temperature is lowered After one round of PCR the number of double-stranded DNA molecules is doubled. TGG TCACTTTGGCAAIAGAATT Heat-stable DNA polymerase adds nucleotides to the 3' end of the primer Primer 1 Primer 2 Heated to 72°C 5 TGCCTGGCCCCATCACTTTGGCAA AGAATTC 5

THANK YOU!!

Answer 1

(1)Heated to 94°C

(2)DNA is denatured

(3)Tempreature is lowered (after adding primers)

(4)Primers hybridize the template

(5)Heat stable DNA polymerase adds the nucleotide sequence to 3' end of the primer.

(6)Heated to 72°c

(7)After one round of PCR the number of double stranded DNA molecules is doubled.