which type of RNA is responsible for bringing the correct amino acids to the mRNA transcript
Homework Answers
The tRNA (transfer RNA): It has clover leaf structure & common to all tRNA structure & it carries amino acids to the mRNA during translation on cytosolic rRNA. It has anticodon site to bind to the mRNA and to displace mRNA transcript from nuclear region onto the rRNA for protein synthesis. It is considered as an adaptor molecule mainly consists of 76 to 90 ribonucleotides in length.
Add Answer to:
which type of RNA is responsible for bringing the correct
amino acids to the mRNA transcript
Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript...
Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript containing 1200 bases, which is translated into a protein containing 300 amino acids. A. How long is the coding sequence in this mRNA and how many nucleotides are in the UTRs? For the purposes of this question we are ignoring the G’ cap and the polyA tail. B. A mutant form of the gene created by one nucleotide being changed to another nucleotide also...
How are the correct amino acids brought to the rib... How are the corect amino acids...
How are the correct amino acids brought to the rib... How are the corect amino acids brought to the ribosomes for protein synthesis? The amino acids are synthesized directly at the ribosomes by the hydrolysis of dietary protein. OAmino acids are carried in the interior of the DNA double helix, then carried to the ribosomes. OAcetyl-CoA carries the amino acids that match the codon on DNA. O Transfer RNA molecules, whose anticodon loop contains the complementary sequence of an MRNA...
Using the following mRNA sequence, order the amino acids (which it codes for) in the correct...
Using the following mRNA sequence, order the amino acids (which it codes for) in the correct sequence: mRNA: 5' - AUGUACCGAAUUGCCUAA -3' 3_Isoluceine 4 Alanine 1 Tyrosine 2 Stop 5 Methionine 6 Arginine Question 16 RNA polymerase Il promoters are located on theof each transcription unit. https://d21 rose.edu/d21/lmslquizzina/userattemptiquiz start framed2???:136082&isprv-8drc=0&qí 200802&cfq_0&dnb-0 5/6/2018 Quiz Submissions-CH 11 Hw Quiz-BIOL 2103 #2787 (Online) | Cell Biology. Rose State College 1) Outside 2) N-terminal 3) Inside 4) 3 side 5) 5'side
Which of the following are directly involved in translation? Choose all five correct answers. mRNA amino...
Which of the following are directly involved in translation? Choose all five correct answers. mRNA amino acids helicase rRNA DNA template RNA polymerase basal transcription factors tRNA initiation and termination factors (proteins) sigma
QUESTION 1 RNA poll initiates synthesis of the mRNA transcript without a primer True O False...
QUESTION 1 RNA poll initiates synthesis of the mRNA transcript without a primer True O False QUESTION 2 En The +1 position identifies the location for translation to begin when bound the mRNA is bound by the ribosomal subunit. True False QUESTION 3 The small ribosomal subunit binds the mRNA transcript at a sequence that is complementary to the gene promoter in order to initiate translation. O True False QUESTION 4 The 5' cap is necessary for protection from exonuclease...
RNA polymerase is the enzyme responsible for the synthesis of RNA polymerase is the enzyme responsible...
RNA polymerase is the enzyme responsible for the synthesis
of
RNA polymerase is the enzyme responsible for the synthesis of O A. protein O B. ATP O C. RNA O D. amino acids
Which of the following statements regarding nucleic acids is correct? A. mRNA codes for proteins. B....
Which of the following statements regarding nucleic acids is correct? A. mRNA codes for proteins. B. tRNA makes lipids C. mRNA codes for DNA D. tRNA makes amino acids
During translation, a polypeptide chain is created using a RNA template. Which of the following components...
During translation, a polypeptide chain is created using a RNA template. Which of the following components is responsible for bringing amino acids to the growing polypeptide chain? Multiple Choice o o o o O RNA polymerase o
OnuA sran A T TA CGATCTG CA CAAGACTT C Transcription mRNA strand Amino Acids ORNA Strand C GTACGA...
onuA sran A T TA CGATCTG CA CAAGACTT C Transcription mRNA strand Amino Acids ORNA Strand C GTACGAATTGCCAATTA CT Transcription mRNA strand: Amino Acids TA C G G A A T C GATG CGCGCACT ONA Strand RNA strand Translation 59. ad TA CCCATGGGGAAATATC ONA Strand mRNA strand Amino Acds randG CGCTA CA A TTGGATCG Translation Amino Acids ONA Strand GACUAGCUGGGGGUAUUACUUUUA G Transcription Translation DNA Strand ACCGCTCCGCCGTCGACAATACCACT ranscription mRNA strand Transcription A CCACCCCCGUAUGGCUGGGAAUAUC Anticodor
onuA sran A T TA CGATCTG CA...
Translation uses ___ and ____ to synthesize ________ a) mRNA, DNA, amino acids b) mRNA, rRNA,...
Translation uses ___ and ____ to synthesize ________ a) mRNA, DNA, amino acids b) mRNA, rRNA, polypeptide chains c) mRNA, tRNA, polypeptide chains d) rRNA, tRNA, amino acids Teacher says a is wrong
How are the correct amino acids brought to the rib... How are the corect amino acids brought to the ribosomes for protein synthesis? The amino acids are synthesized directly at the ribosomes by the hydrolysis of dietary protein. OAmino acids are carried in the interior of the DNA double helix, then carried to the ribosomes. OAcetyl-CoA carries the amino acids that match the codon on DNA. O Transfer RNA molecules, whose anticodon loop contains the complementary sequence of an MRNA...
Using the following mRNA sequence, order the amino acids (which it codes for) in the correct sequence: mRNA: 5' - AUGUACCGAAUUGCCUAA -3' 3_Isoluceine 4 Alanine 1 Tyrosine 2 Stop 5 Methionine 6 Arginine Question 16 RNA polymerase Il promoters are located on theof each transcription unit. https://d21 rose.edu/d21/lmslquizzina/userattemptiquiz start framed2???:136082&isprv-8drc=0&qí 200802&cfq_0&dnb-0 5/6/2018 Quiz Submissions-CH 11 Hw Quiz-BIOL 2103 #2787 (Online) | Cell Biology. Rose State College 1) Outside 2) N-terminal 3) Inside 4) 3 side 5) 5'side
QUESTION 1 RNA poll initiates synthesis of the mRNA transcript without a primer True O False QUESTION 2 En The +1 position identifies the location for translation to begin when bound the mRNA is bound by the ribosomal subunit. True False QUESTION 3 The small ribosomal subunit binds the mRNA transcript at a sequence that is complementary to the gene promoter in order to initiate translation. O True False QUESTION 4 The 5' cap is necessary for protection from exonuclease...
RNA polymerase is the enzyme responsible for the synthesis
of
RNA polymerase is the enzyme responsible for the synthesis of O A. protein O B. ATP O C. RNA O D. amino acids
During translation, a polypeptide chain is created using a RNA template. Which of the following components is responsible for bringing amino acids to the growing polypeptide chain? Multiple Choice o o o o O RNA polymerase o
onuA sran A T TA CGATCTG CA CAAGACTT C Transcription mRNA strand Amino Acids ORNA Strand C GTACGAATTGCCAATTA CT Transcription mRNA strand: Amino Acids TA C G G A A T C GATG CGCGCACT ONA Strand RNA strand Translation 59. ad TA CCCATGGGGAAATATC ONA Strand mRNA strand Amino Acds randG CGCTA CA A TTGGATCG Translation Amino Acids ONA Strand GACUAGCUGGGGGUAUUACUUUUA G Transcription Translation DNA Strand ACCGCTCCGCCGTCGACAATACCACT ranscription mRNA strand Transcription A CCACCCCCGUAUGGCUGGGAAUAUC Anticodor
onuA sran A T TA CGATCTG CA...
Most questions answered within 3 hours.
-
A small body of mass m performs small oscillations sliding (no
rolling) along the bottom of...
asked 2 minutes ago -
The electric field in the region between two oppositely charged,
parallel, conducting plates has a magnitude...
asked 2 minutes ago -
A simple random sample was taken to test the claim that the
population mean is no...
asked 1 hour ago -
A set of length measurements are obtained with the values 165.6
± 0.3, 165.1± 0.4,166.4± 1.0,...
asked 1 hour ago -
1. Which of the following is true about unconscionable
contracts?
a. A term is substantially unconscionable...
asked 16 minutes ago -
A company is interested in estimating the costs of lunch
in their cafeteria. After surveying employees,...
asked 48 minutes ago -
A 0.2m diameter ball with an initial velocity of 8m/s rolls up a
hill without slipping....
asked 31 minutes ago -
I want to redraft the solution, using other words , use your own
words don't copy...
asked 20 minutes ago -
Hyundai Motors is considering threesites—A, B,C —at which to
locate a factory to build its new-model...
asked 22 minutes ago -
Learning Outcomes:
Upon the successful completion of this module, you should
understand the following concepts:
Strategic...
asked 23 minutes ago -
Identify four of the five major types of organizations within
the federal bureaucracy, and give examples...
asked 31 minutes ago -
The following data have been obtained
for the effect of solvent composition on the solubility of...
asked 32 minutes ago