TA C G G A A T C GATG CGCGCACT ONA Strand RNA strand Translation 59. ad TA CCCATGGGGAAATATC ONA Strand mRNA strand Amino Acds
randG CGCTA CA A TTGGATCG Translation Amino Acids ONA Strand GACUAGCUGGGGGUAUUACUUUUA G Transcription Translation
DNA Strand ACCGCTCCGCCGTCGACAATACCACT ranscription mRNA strand Transcription A CCACCCCCGUAUGGCUGGGAAUAUC Anticodor
Homework Answers
Coding strand of DNA is same as mRNA except uracil (U) is present in mRNA at place of thymine (T) in DNA.
mRNA is complementary to tRNA.
Stop codons (UAG, UGA, UAA) do not code for any amino acid.
Add Answer to:
OnuA sran A T TA CGATCTG CA CAAGACTT C Transcription mRNA strand Amino Acids ORNA Strand C GTACGA...
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence...
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
List the steps involved in the transcription and translation of DNA into mRNA and tRNA in order? DNA replicated to RNA t...
List the steps involved in the transcription and translation of DNA into mRNA and tRNA in order? DNA replicated to RNA tRNA translates mRNA and adds amino acids to the growing peptide chain making a protein mRNA leaves nucleus Introns are excised from hnRNA Addition of 5' cap and poly-A tail to mRNA
PLEASE HELP WITH TABLE.thank you 1.Select the coding strand, and select the template strand from the...
PLEASE HELP WITH TABLE.thank you
1.Select the coding strand, and select the template strand from
the answers below. (Select more than 1 answer)
The coding strand is the first strand running from 5' to 3'.
The coding strand is the second strand running from 3' to
5'.
The template strand is the second strand running from 3' to
5'.
The template strand is the first strand running from 5' to
3'.
2.Given DNA sequence: 5’ TCCGATTGG 3’. Which of the...
Which of the following is involved in both transcription and translation? A. amino acids B. DNA...
Which of the following is involved in both transcription and translation? A. amino acids B. DNA C. messenger RNA D. ribosomes E. transfer RNA
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND...
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND = = = = = = = = = = = = = = > TG A G C T A C CAC T T T A A c T C G AT GGT GAA AT DNA 3' STRAND < = = = = = = = = = = = = = = 5 A. In the following spaces, fill in the blanks...
Translation uses ___ and ____ to synthesize ________ a) mRNA, DNA, amino acids b) mRNA, rRNA,...
Translation uses ___ and ____ to synthesize ________ a) mRNA, DNA, amino acids b) mRNA, rRNA, polypeptide chains c) mRNA, tRNA, polypeptide chains d) rRNA, tRNA, amino acids Teacher says a is wrong
1. Which of the following statements concerning transcription of bacterial mRNA is not true? Bacterial mRNA...
1. Which of the following statements concerning transcription of bacterial mRNA is not true? Bacterial mRNA must have intron material removed before it can be used in the process of protein translation.* Energy necessary for transcription is provided by the breaking of phosphate bonds carried by ribonucleotide triphosphates (rNTPs). A sigma factor recognizes the promoter site sequences on the DNA strand during transcription. A guanine-rich sequence on the template DNA molecule causes the growing RNA strand to loop and detach.
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c....
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c. termination factor b. tRNA d. transcription initiator 26. What is typically attached to the acceptor end of a tRNA? a. a protein b. an amino acid C a ribosome d. a nucleosome 27. During mRNA processing, what is put on the 3' end of a primary mRNA transcript? a. a poly-A tail b. a cap d. an intron c. an exon 28. Which of...
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
PLEASE HELP WITH TABLE.thank you
1.Select the coding strand, and select the template strand from
the answers below. (Select more than 1 answer)
The coding strand is the first strand running from 5' to 3'.
The coding strand is the second strand running from 3' to
5'.
The template strand is the second strand running from 3' to
5'.
The template strand is the first strand running from 5' to
3'.
2.Given DNA sequence: 5’ TCCGATTGG 3’. Which of the...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND = = = = = = = = = = = = = = > TG A G C T A C CAC T T T A A c T C G AT GGT GAA AT DNA 3' STRAND < = = = = = = = = = = = = = = 5 A. In the following spaces, fill in the blanks...
1. Which of the following statements concerning transcription of bacterial mRNA is not true? Bacterial mRNA must have intron material removed before it can be used in the process of protein translation.* Energy necessary for transcription is provided by the breaking of phosphate bonds carried by ribonucleotide triphosphates (rNTPs). A sigma factor recognizes the promoter site sequences on the DNA strand during transcription. A guanine-rich sequence on the template DNA molecule causes the growing RNA strand to loop and detach.
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c. termination factor b. tRNA d. transcription initiator 26. What is typically attached to the acceptor end of a tRNA? a. a protein b. an amino acid C a ribosome d. a nucleosome 27. During mRNA processing, what is put on the 3' end of a primary mRNA transcript? a. a poly-A tail b. a cap d. an intron c. an exon 28. Which of...
Most questions answered within 3 hours.
-
Oakdale Fashions, Inc. had $245,000 in 2018 taxable income.
Using the tax schedule in Table 2.3...
asked 8 minutes ago -
The marketing class at CSUS had an average score of 150. An
educational analyst determined that...
asked 1 hour ago -
Justin Case has purchased a $250 000 home by putting 20 % down
and taking out...
asked 1 hour ago -
1. In a labor market, marginal cost for a firm is
____________.
a. recruiting cost
b....
asked 2 hours ago -
On January 1, 2019, ABC Company issued $60,000,000 of 20-year,
10.5% bonds when the market rate...
asked 2 hours ago -
39.4% of US homes continue to use a landline in addition to cell
phone service. 3...
asked 3 hours ago -
Starting with benzene, synthesize 1-phenyl-1-butyne.
Show intermediates and reagents.
asked 4 hours ago -
Create a 32-run crossed array design with six control factors
and two noise factors such that...
asked 4 hours ago -
A 500g sample of sand from source A has the following amounts
retained on each sieve....
asked 5 hours ago -
In
your own words, please explain the essay by John Keynes wrote "The
End of Laissez...
asked 5 hours ago -
How are the matrix and pixels related? Why are smaller
pixels better for diagnostic quality?
asked 5 hours ago -
2. An AC generator has 80 rectangular loops on
its armature. Each loop is 11 cm...
asked 5 hours ago