When the exonuclease 3'-5' has 100 % activity the misincorporation rate is 1 in 10,000,000.
When the exonuclease 3'-5' has only 60% activity the misincorporation rate will be 1 in
( 10000000 x 60) /100
=6,000,000
There for the misincorporate rate will be 1 in 6,000,000.
4. The enzyme DNA polymerase has two important activities: 5-10-3 polymerase and 3 '-10-5'exonuclease. The 5'-to-3'...
1. Which of the following statements applies to the 5' - 3' exonuclease activity of DNA polymerase I? You may select multiple answers. a. It allows the enzyme to remove the primer from the primer's 5' end. b. It allows the enzyme to proofread itself. c. It cuts phosphodiester bonds. d. It is used to synthesize a new DNA molecule. e. It is used to seal together Okazaki fragments. 2. Which enzyme are able to proofread themselves? Select all that...
How DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? 5. What is DNA replication?, 6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order. a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. b. The DNA double helix breaks or unzips down the middle between the base pairs. C. A complementary strand...
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...
1. DNA Structure and Replication fill in the blanks. 10pts and , have two nitrogenous rings and are a. The bases, called direction and reads the b. DNA Polymerase synthesizes new DNA in the template DNA strand in the direction. c. DNA polymerases use -exonuclease activity to proofread newly synthesized DNA. Whereas, DNA Pol I uses _-exonuclease activity to remove RNA primers. d. The enzyme telomerase synthesizes using as a template. e. DNA Replication begins at the and two ,,...
70. RNA synthesis in bacteria requires which of the following? a. DNA polymerase III b. A primer c. A DNA template d. DNA Gyrase e. Deoxyribonucleotide triphosphate 86. Two phenotypically normal people have 4 children. 3 are phenotypically normal like their parents, but one is an albino. What are the probable genotypes of the parents? a. Both parents are homozygous dominant b. Both parents are homozygous recessive c. One parent is homozygous dominant and the other is homozygous recessive d....
1. An enzyme used to covalently join DNA segments to form recombinant DNA molecules is called a A. Restriction endonuclease B. Reverse transcriptase C. DNA polymerase D. Helicase E. Ligase 7. The procedure for introducing changes into specific genes is called A. An enhancer trap B. Imprinting C. RT-PCR D. DNA looping E. Gene targeting 2. Plasmids used for in vitro cloning of foreign DNA fragments are called A. Donors B. DNA chips C. Clones D. Vectors E. Conjugants 8....
28
29
30
31
32
33
28. Genes found in segments of chromosome called heterochromatin would likely be expressed at high levels. expressed at low levels, or not at all. deleted before replication. maternally inherited only. none of these 29. (Use this representation to answer the following question.) DNA template strand 5 3' DNA complementary strand 3' 5' Using the double-stranded molecule above, in which direction does the RNA polymerase enzyme move? 3' → 5' along the template strand 5'...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
ID: 4 A new sugar, sugarose, induces synthesis of two anxvmes from the sug operon or are know to be involved in sugarose utilization. The table below shows the induction of two enzymes from the sug operon of E. coll. Four genes enzymes in strains carrying doletion mutations co ntion affecting each on Here, ' means the enzyme is induced normally, 'C' means the enzyme '0' means the enzyme is never detected. cod normally, 'C' means the enzyme was synthesized...
Question 33 2 pts Which of the following statements about the process of DNA replication is true? It involves the enzyme DNA ligase, which corrects point mutations. It utilizes DNA polymerase, which catalyzes the reaction that adds a new nucleotide to the growing strand. The sequence on the new strand is always identical to one of the old parent strands. Adenine pairs with guanine, and cytosine pairs with thymine. Question 34 2 pts The DNA base...