1) The following DNA template is transcribed. What is the correct transcript?
3'-GGGTTTTCAGCG-5'
2) Compound X is mutagen is a base analog that can be incorporated opposite either cytosine or thymine during replication. In subsequent rounds of replication, when DNA containing compound X is replicated, it always pairs with thymine. What type of mutation would you expect compound x to cause?
a. C : G -> T : A
b. T : A -> C : G
c. C : G -> G : C
d. C : G -> A : T
e. T : A -> G : C
We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
1) The following DNA template is transcribed. What is the correct transcript? 3'-GGGTTTTCAGCG-5' 2) Compound X...
There is only ONE correct answer. Attached at the bottom is an information "Help" sheet that may or may not contain useful information pertaining to this question. 19. The integrity of the genetic code relies on high-fidelity DNA replication, in which information in a template strand of DNA is transferred to the newly synthesized daughter strand (with A opposite T, and G opposite C). In class, we discussed the results of an experiment in which an unnatural thymine isostere called...
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
Question 33 2 pts Which of the following statements about the process of DNA replication is true? It involves the enzyme DNA ligase, which corrects point mutations. It utilizes DNA polymerase, which catalyzes the reaction that adds a new nucleotide to the growing strand. The sequence on the new strand is always identical to one of the old parent strands. Adenine pairs with guanine, and cytosine pairs with thymine. Question 34 2 pts The DNA base...
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...
1. Which sequence of mRNA is produced from this DNA template: 3" A-T-A-G-C-T-A 5' ? 2. As a result of mutation, DNA sequence 5' A-G-A-T-G-A-C-T-G-A-A-G-T-C 3' changed into 5' A-G-A-T-G-A-C-T-G-A-G-T-C 3'. Which type of mutation is this? 3. What is the result of the following reaction" Fructose-6-phosphate + ATP (phosphofructokinase) -------> ? 4. Which steps of glycolysis are irreversible and used for its regulation (just step numbers are okay)? 5. What are the products of one turn of the citric...
1. Which of the following statements is FALSE? Helicase activity 'unwinds DNA making the double-stranded molecule into single strands. b. The leading strand of DNA is started by an RNA primer The lagging strand of DNA is synthesized as "Okazaki fragments", cach with its own RNA primer. DNA replication proceeds in both directions around the bacterial chromosome. DNA polymerase synthesives new DNA in one direction (3 to 5) only. 2. Which of the following would be found in eukaryotes? a....
4. In a lake governed by the food web shown in the image to the right, 500 brown trout are added from fisheries. Which of the following outcomes would most likely be expected? A. Tadpole population will increase B. Duck population will decrease C. Algae population will increase D. Lilly Pad population will decrease E. Caddis Fly larvae will increase 5. Which of the following pieces of evidence most strongly supports a common ancestor of all life on Earth? A....
can u tell me if these answers are correct please!??!!! Choose the best answer for the following questions. Place your answer on the line. If your answer is not on the line.it does not count 1 Mender's discovery that characteristics are inherited due to the transmission of hereditary factors resulted from his (1) dissections to determine how fertilization occurs in pea plants (2analysis of the offspring produced from many pea plant crosses (3) careful microscopic examinations of genes and chromosomes...
1. Describe the functions of the following reagents in extraction of DNA from corn meal: proteinase K; guanidine HCI; SDS 2. Why is the ratio of the OD at 260 and 280 nm used to estimate DNA purity? 3. In one paragraph, summarize basic principles of PCR technique in your own words. List all the reagents you will need to perform a PCR experiment. Does this method tell you what genetic modifications were made? If yes, describe how you can...
1. Which of the following are the sites within the human body where carbon dioxide and oxygen are exchanged? A. Alveoli B. Arteries C. Synapses D. Venules 2. Which of the following describes the most important reason for repeating an experimental investigation? A. To verify the validity of the original findings B. To expand upon the original investigation C. To manipulate the independent variable D. To attempt to disprove the hypothesis 3. Lithium has an atomic number of 3 and...