1. DNA is the genetic material that stores the information necessary to generate a polypeptide sequence of a protein in the form of nitrogen bases.
2. Messenger RNA (mRNA) is produced by a process known as transcription from DNA. The role of mRNA is to transfer the information in DNA to the ribosomes where the translation occurs.
3. Transfer RNAs (tRNAs) are clover leaf like structures which carry different aminoacids based on their anticodon region. These give aminoacids to growing polypeptide chain at ribosomes during translation.
4. Ribosomes are the site of translation where the genetic information translates into proteins. mRNA gets attach to ribosomes and moves along. For each triplet of codon moves on a single amino acid increases in the growing polypeptide chain.
1a.State what role each of molecules listed below plays in protein synthesis (translation and/or transcription) 1....
Mae each cellular component to a role in transcription or translation in eukaryotic cells. protein complex that makes RNA polymers corresponding to a DNA template RNA polymerase Answer Bank location where transcription occurs TRNA region of DNA that recruits the transcriptional machinery promoter provides amino acids to growing protein chain ribosome site of protein synthesis nucleus about us | Careers privacy policy terms of use contact us help
EXERCISE 3-9 Write the appropriate term in each blank from the list below. Not all terms will be used. DNA nucleotide messenger RNA (mRNA) transcription ribosomal RNA (RNA) translation transfer RNA (tRNA) 1. The process by which RNA is synthesized from the DNA 2. A building block of DNA and RNA 3. An important component of ribosomes 4. The structure that carries amino acids to the ribosome 5. The nucleic acid that carries information from the nucleus to the ribosomes...
Complete a concept map of translation, indicate where it takes place, and describe what will happen if the anticodon is not attached to transfer RNA. A)DNA unzips ?transcription of mRNA ? mRNA leaves nucleus ? mRNA binds to ?ribosome ? tRNA brings in amino acid? tRNA anticodon binds to codon on mRNA ? peptide bond binds amino acids to form protein ? transport of the amino acids to the mRNA by tRNA continues until the mRNA translation is completed. This...
s141) Which nucleotide is used for energy to drive protein synthesis? A) TTP B) CTP C) UTP D) GTP 2) Ribosomal RNA: A) Can bind to prokaryotic mRNA B) Plays no role in peptidyl transferase activity C) In eukaryotes, attaches to mRNA before transcription is completed D) All of the above 3) Spliceosomes: A) Are 40-60S, about the size of ribosomal subutnit B) Are necesssary for DNA replication C) Bind to RNA Polymerase D) Are composed entirely of proteins E)...
the several other 10.4 to show t 3. The base uracil substitutes for the base thymine in RNA. Complete Table ways RNA differs from DNA Table 10.4 DNA Structure Compared with RNA Structure RNA Sugar Bases Strands Helix DNA Deoxyribose Adenine, guanine, thymine, cytosine Double stranded with base pairing Yes Complementary Base Pairing Complementary base pairing occurs between DNA and RNA. The RNA base uracil pairs with the DNA base adenine; the other bases pair as shown previously. Complete Table...
1. Transcription occurs in the a. Nucleus. b. Ribosomes of the Rough Endoplasmic Reticulum. c. Mitochondrion. d. Cell membrane. e. Smooth Endoplasmic Reticulum. 2. The monomers of DNA and RNA are a. amino acids. b. monosaccharides. c. nucleotides. d. fatty acids. e. nucleic acids. 3. Which of the following statements regarding DNA is false? a. DNA uses the nitrogenous base uracil. b. DNA is a nucleic acid. c. One DNA molecule can include four different nucleotides in its structure. d....
BI U A. A. EEE 1. What is replication? 2. What is Transcription? 3. What are the differences between replication and transcription? 4. What is translation? 5. What is the role of mRNA, TRNA, and tRNA during translation? 6. What is the function of ribosomes? 7. Which enzyme catalyzes the transcription? 8. A DNA molecule has two strands (double helix) - how many of its strands are/is replication and transcription? 9. What is the difference between transcription and translation occurring...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
1. A is a unit of nucleic
Select the appropriate term from the table below to complete eacALUlllllell. tRNA rRNA replication transcription translation DNA. deletion translocation frame shift nucleus a l. A Duckohde unit of nucleic acid containing a sugar attached to is a phosphate group and a base. 2. The site of transcription is the the ribosome moves along the mRNA. 3. In the process of 4. A class of RNA molecules which is linked directly with protein synthesis,...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...