Problem 4 (hand-calculation): Consider the constant-pressure specific heat of air at high temperature presented in ta- ble 4, where T is the temperature and Cp is the specific heat. Determine a least squares quadratic polynomial approximation for this set of data. The quadratic polynomial has the following form: Cp = a + bT+cT. where the coefficients a, b and c are to be determined using the least squares method. Hint Follow the derivation of linear regression discussed in class. You...
Question 5 (2.0 pts) Assume that Cp for an ideal gas is given by co(T) = 0.9 + 2.5 x 10-* T, in kJ/kg-K, where is the temperature in Kelvin. (Use the gas constant R = 0.3 kJ/kg-K) (a) (+0.4) Derive an expression for Cy as a function of temperature. The gas undergoes an isochoric process from a temperature T, = 400 K to T2 = 500 K. Calculate the change in (b) (+0.6) enthalpy, in kJ/kg, (c) (+0.6) entropy,...
Although ferrocene is quite stable, the following two reactions go readily: LiAlH4 Co(Cp)2 -C10HCO Ni(CP)2 Na(Hg) -C10H12Ni Suggest structures for the two products of these reactions and explain the different reactivities in terms of the E.A.N. rule. (Cp is cyclopentadiene.)
onuA sran A T TA CGATCTG CA CAAGACTT C Transcription mRNA strand Amino Acids ORNA Strand C GTACGAATTGCCAATTA CT Transcription mRNA strand: Amino Acids TA C G G A A T C GATG CGCGCACT ONA Strand RNA strand Translation 59. ad TA CCCATGGGGAAATATC ONA Strand mRNA strand Amino Acds randG CGCTA CA A TTGGATCG Translation Amino Acids ONA Strand GACUAGCUGGGGGUAUUACUUUUA G Transcription Translation DNA Strand ACCGCTCCGCCGTCGACAATACCACT ranscription mRNA strand Transcription A CCACCCCCGUAUGGCUGGGAAUAUC Anticodor
onuA sran A T TA CGATCTG CA...
Ta linear transformation. T: PzR3 16-c [brord Give a basis for Kert T(at abt*ct+d)=f656
Derive a linear expression for Cp(T) of liquid ethanol if Cp(0oC) = 103.1 J/mol oC and Cp(100oC) = 158.8 J/mol oC. Use the derived expression and data in Table B.1 to calculate the heat transfer rate (kW) required to bring a stream of liquid ethanol flowing at 75.0 L/s from 25 oC to the boiling point at 1 atm
Stream Type T. (°C) T(°C) CP (kW/°C) 1 ATmin= 10 1 2 3 Hot Hot Cold Cold 180 130 60 30 80 40 100 1 20 4 1.8 1. Develop a temperature interval diagram 2. Produce a problem table from the temperature interval diagram 3. Using heat cascade, state the pinch point, Hot & cold utility usage 4. What is the minimum number of units a) For max energy recovery b) Energy relaxation across pinch 5. Design a HEX network...
(a) Express (∂Cp/∂P)T as a second derivative of H and find its relation to (∂H/∂P)T. (b) From the relationships found in (a), show that (∂Cp/∂V)T=0 for a perfect gas.
find v0 in
the following circuit
Este los co po?'J 220e AF OOk. ta IK LM741 47k7
Este los co po?'J 220e AF OOk. ta IK LM741 47k7
In the simple Keynesian model, taxes do not depend on income (T
= Ta). Suppose Ta = 80 and:
C = 250 + 0.75 YD
Ip = 64
G = 100
NX = 20
A. Calculate the equilibrium GDP and show graphically. What is
the budget surplus (or deficit)? Hint: BS = T - G
B. Suppose in order to reduce the deficit, government spending
is reduced by 20 (from 100 to 80. Calculate the new equilibrium GDP
and show...