Homework Answers
18) Sanger sequencing is a method of gene sequencing.
- Uses normal replication machineries and additionally use dideoxy nucleotides.
- Dideoxy nucleotides are nucleotides in which 2' and 3' hydoxyl groups removed.
- Usually DNA polymerase add incoming nucleotides to the 3' OH of existing nucleotide sequence during chain elongation.
- Here, the elongation and replication progresses normally and in between a dideoxy nucleotide incorperates instead of normal nucleotides.
- Due to the absence of 3' OH in dideoxy nucleotides, the reaction do not progress further. Thus the termination occurs.
Add Answer to:
Sanger sequencing or dideoxy sequencing of DNA causes termination of replication. Why? 18.
Q1) List the limitations and challenges of dideoxy termination method of DNA sequencing? Q2) In the...
Q1) List the limitations and challenges of dideoxy termination method of DNA sequencing? Q2) In the context of mutation detection, describe the differences between first- and second-generation sequencing? Q3) 6-year-old child presenting with sensorineural deafness, sequencing of MYO15A gene by Sanger method was performed and showed the following chromatogram: A- Describe the principle of Sanger sequencing method? B- Describe the DNA change: position, type of variant and genotype?
Q1) List the limitations and challenges of dideoxy termination method of DNA sequencing? Q2) In the...
Q1) List the limitations and challenges of dideoxy termination
method of DNA sequencing?
Q2) In the context of mutation detection, describe the
differences between first- and second-generation sequencing?
Q3) 6-year-old child presenting with sensorineural deafness,
sequencing of MYO15A gene by Sanger method was performed
and showed the following chromatogram:
Describe the principle of Sanger sequencing method?
Describe the DNA change: position, type of variant and
genotype?
פ ס פ פ פ פ פ vs 12 5 פס . פ פ...
9. (8 points) Use the figure below to answer the following questions about Sanger Dideoxy sequencing....
9. (8 points) Use the figure below to answer the following questions about Sanger Dideoxy sequencing. GATC 11.1 This figure represents a portion of a polyacrylamide gel used to separate DNA fragments produced from a Sanger dideoxy DNA sequencing reaction. Write the sequence of the boxed portion of the newly synthesized (nascent) strand (in the 5' to 3' direction). Label the 5' and 3' ends of the DNA sequence. 11 il Write the DNA sequence of the complementary template strand...
What is the sequence of the template DNA used to make this Sanger (chain termination) sequencing...
What is the sequence of the template DNA used to make this Sanger (chain termination) sequencing gel? A C GT a.5' - TTGGCCAAA - 3 6.5' - AAACCGGTT-3' OC. 5'- ATGGACTCA - 3 d. 5'-ACTCAGGTA - 3' e. 5' - TGAGTCCAT - 3'
ddATP ddCTP ddGTP ddTTP The autoradiogram shown was obtained from a DNA sequencing method called Sanger...
ddATP ddCTP ddGTP ddTTP The autoradiogram shown was obtained from a DNA sequencing method called Sanger sequencing or dideoxy sequencing. The arrow shows the direction of migration of the DNA samples during electrophoresis. Determine the sequence of the DNA template strand, in the 5' to 3' direction, from this data. 5' – CGTCAATTTAG
Compare Sanger sequencing and NGS 1. Sanger Sequencing: Amount of DNA (high/low)? Sequence mixed DNA (Yes/No)?...
Compare Sanger sequencing and NGS 1. Sanger Sequencing: Amount of DNA (high/low)? Sequence mixed DNA (Yes/No)? Efficiency (high/low)? 2. NGS Amount of DNA (high/low)? Sequence mixed DNA (Yes/No)? Efficiency (high/low)?
All of the following are DNA sequencing techniques except___. Select all that apply A) pyrosequecing B)...
All of the following are DNA sequencing techniques except___. Select all that apply A) pyrosequecing B) mullis chain terminating sequencing c) sanger dideoxy sequencing d) DNA fingerprinting e) Illumina sequencing
3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned...
3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned into a vector and then the vector DNA is denatured and subjected to dideoxy DNA sequencing method. Below is the DNA sequence from a region of the vector. 5’GGGCTAGCCGGATCCATGACTAGTCCGACTTACTGACCATCGACTCATCC-3’ 3-CCCGATCGGCCTAGGTACTGATCAGGCTGAATGACTGGTAGCTGAGTAGG-5’ To which DNA strand does the primer bind, the top or bottom one? Based on the sequence above, what would be the sizes of the bands (i.e., the number of nucleotides in each band)...
Would anyone care to compare and contrast the Sanger and Maxam-Gilbert methods of DNA sequencing? Why...
Would anyone care to compare and contrast the Sanger and Maxam-Gilbert methods of DNA sequencing? Why is one preferred over the other?
Which of the following make(s) sequencing by the Sanger chain-termination method possible? (Selec...
Which of the following make(s) sequencing by the Sanger chain-termination method possible? (Select all that apply.)12.17 a. Complementary single-stranded nucleic acid sequences can come together to form a duplex molecule. b. Single-stranded nucleic acid molecules can be immobilized on certain types of filter paper. c. A DNA strand whose 3' end terminates in a dideoxynucleotide cannot be elongated. d. Duplex nucleic acid molecules can be separated by size by means of electrophoresis. e. New nucleotides are added only to the...
Q1) List the limitations and challenges of dideoxy termination
method of DNA sequencing?
Q2) In the context of mutation detection, describe the
differences between first- and second-generation sequencing?
Q3) 6-year-old child presenting with sensorineural deafness,
sequencing of MYO15A gene by Sanger method was performed
and showed the following chromatogram:
Describe the principle of Sanger sequencing method?
Describe the DNA change: position, type of variant and
genotype?
פ ס פ פ פ פ פ vs 12 5 פס . פ פ...
9. (8 points) Use the figure below to answer the following questions about Sanger Dideoxy sequencing. GATC 11.1 This figure represents a portion of a polyacrylamide gel used to separate DNA fragments produced from a Sanger dideoxy DNA sequencing reaction. Write the sequence of the boxed portion of the newly synthesized (nascent) strand (in the 5' to 3' direction). Label the 5' and 3' ends of the DNA sequence. 11 il Write the DNA sequence of the complementary template strand...
What is the sequence of the template DNA used to make this Sanger (chain termination) sequencing gel? A C GT a.5' - TTGGCCAAA - 3 6.5' - AAACCGGTT-3' OC. 5'- ATGGACTCA - 3 d. 5'-ACTCAGGTA - 3' e. 5' - TGAGTCCAT - 3'
ddATP ddCTP ddGTP ddTTP The autoradiogram shown was obtained from a DNA sequencing method called Sanger sequencing or dideoxy sequencing. The arrow shows the direction of migration of the DNA samples during electrophoresis. Determine the sequence of the DNA template strand, in the 5' to 3' direction, from this data. 5' – CGTCAATTTAG
Most questions answered within 3 hours.
-
the following reaction occurs in a balloon containing
N2O2 gas
N2O4(g)=2NO2(g)
will the volume of the...
asked 21 minutes ago -
answer the questions throughout this program
public class Day implements Comparable {
Private Boolean atWork;...
asked 28 minutes ago -
This is C++ code for parking fee management program
#include <iostream>
#include <iomanip>
using namespace std;...
asked 39 minutes ago -
The free energy change for the following reaction at 25 °C, when
[Sn2+] = 1.17 M...
asked 2 hours ago -
An MNE is this kind of industry when competition in one country
is essentially independent of...
asked 3 hours ago -
. For this set of questions, determine what
proportion of a normal distribution is located betweeneach...
asked 4 hours ago -
A college student is employed as a door-to-door newspaper
salesman. Historical data suggests that the student...
asked 5 hours ago -
MATLAB HW 11 problem using Switch Case and Input commands
Write a script file that calculates...
asked 5 hours ago -
Considering gravitational time dilation, calculate the time that
passes in Earth’s surface while 1 hour passes...
asked 5 hours ago -
Minitab Problem: Take the Lake Hume June rainfall data and find
use the processes outlined in...
asked 6 hours ago -
X Company is trying to decide whether to continue using old
equipment to make Product A...
asked 6 hours ago -
IN PYTHON ONLY !! Program 2: Re-work
program #5 (WeeklyHours) from the previous assignment such that...
asked 7 hours ago