Genetic engineers are trying to construct a new type of bacterial cell in which one of the 20 amino acids, alanine, is replaced by a synthetic amino acid,
b. amino acyl tRNA synthetase.
An aminoacyl tRNA synthetase is an enzyme, which catalyzes the esterification of a specific cognate aminino acid to its compatible cognate tRNAs thus, forming an aminoacyl-tRNA. If this enzyme is not modified, the new amino acid may ot be recognised by the enzyme.
Genetic engineers are trying to construct a new type of bacterial cell in which one of...
The earliest work on the genetic code established UUU, CCC, and
AAA as the codons for Phe, Pro, and Lys, respectively.
Explain the reason why polyG was not used as a translation
template in these experiments.
Match the words in the left column to the appropriate blanks in
the sentences on the right.
RNA polymerase To establish codons for different amino acids Nirenberg and Matthaei polymerized is physically unstable molecules with the to synthesize polyN, a polyribonucleotide containing only one...
2. A substitution mutation is one in which one nucleotide base is changed to another Suggest ONE substitution A G mutation in the DNA that would cause the first amino acid in the "# of Eyes" gene to change from alanine (Ala) to valine (Val). In the table below, write the original.3. There is a substitution mutation in the gene for Fangs in which the first DNA base changes from guanine to thymine. The mutation results in a genetic disorder...
DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your LN) to translate the following mRNA sequences into amino acid sequences and answer the questions. mRNA nucleotide sequence (mRNA1) AUGGCAGACAAUAUUAAGUGA 1. What is the amino acid sequence? Mutation in the mRNA nucleotide sequence (mRNA2) AUGGCAGACCAUAUUAAGUGA 2. What is the new amino acid sequence? 3. How many bases were changed in mRNA2 compared to mRNA1? 4. What type of mutation was this? 5. How many...
1. The type of genetic exchange between bacterial cells that can happen between isolated DNA and a live bacterial cell is: a. conjugation b. transduction c. transversion d. transformation 2. An Hfr strain of E. coli with genotype a+b+c+d+e+f+ is mated with an F¯ auxotrophic strain with the genotype a¯b¯c¯d¯e¯f¯. Conjugation is stopped at 10 minute intervals and the genotypes of the resulting conjugants are determined. The following results are obtained: after 10 minutes e+ after 20 minutes a+ e+...
Acids are, by nature, generally polar compounds. Which bacterial type is likely to be more affected by acid-based disinfectants? Gram-positive bacteria Gram-negative bacteria
Mitosis results in two daughter cells. When comparing the genetic information of the parent cell with that of the two daughter cells, all three are identical. the two daughter cells are identical but slightly different from the parent cell. all three are slightly different. the parent cell and one daughter cell are identical, while the second daughter cell is slightly different. outcome patterns vary. What purpose do restriction enzymes play in bacterial cells? They prevent the overproduction of mRNA in...
QUESTION 45 Conjugation between bacterial cells involves the equal contribution of genetic material from one bacterial cell to the other. True False 2 points QUESTION 46 Is made up of only a single-stranded RNA molecule that does not code for any proteins. Virus Prion Viroid 2 points QUESTION 47 Mutagens can cause mutations by _______. Covalently altering the structure of the nucleotides. Causing errors in DNA replication by disrupting the appropriate pairing between nucleotides. Distorting the helical structure of the...
10. If there were a mutant cell that did not join its Okazaki fragments properly, what enzyme in that cell would be defective? 11. A protein can have any of 4 types of structure. Match the structure type with at least one of the kinds of bond holding it together12. There are 20 different tRNA molecules, one for each of the 20 amino acids found in protein. During protein synthesis, the job of a tRNA molecule is to carry its particular...
Circle the appropriate cell type in which the listed structure or molecule can be found. Note that the structure or molecule can be found in more than one type of cell. cell type structure or molecule A DNA B nucleus animal plant bacterial animal plant bacterial plasma membrane animal plant bacterial D chloroplast E cell wall F lysosome G mitochondriorn H Golgi apparatus animal plant bacterial animal plant bacterial animal plant bacterial animal plant bacterial animal plant bacterial
Part A Which of the following statements accurately describes bacterial cell walls? In bacteria with acid-tast cell walls, the carboxylic acid in the walls forms a layer outside a thin layer of hydrophilic polypeptides. The cell walls of gram-negative bacteria contain many more layers of peptidoglycan than those of gram-positive bacteria. In gram-negative bacteria, the thin layer of peptidoglycan is surrounded by an outer membrane made of phospholipids, lipopolysaccharides, and proteins Gram-negative bacterial cell walls contain teichoic acids, whereas the...