Protein structure is ultimately determined by:
The codon sequence, which is coded for in the ribosome
The order of genes in the genome
The conditions in which the protein is assembled, and nothing else
The primary sequence, which is coded for in DNA
The primary structure of proteins which is just a linear sequence of amino acids joined by peptide bond are the sole determinant of the tertiary and secondary structure of proteins. The sequence of amino acids depends on the codon present in the mRNA that are read by ribosomes.
So option A is correct
Protein structure is ultimately determined by: The codon sequence, which is coded for in the ribosome...
Once an organism's genome sequence has been determined, which of the following methods is not used to identify all the genes within the genome? Question options: a). Search for DNA sequences of genes known from other organisms b. Individually mutate nucleotides and determine which mutations cause a detectable phenotype c. Sequence cDNAs from different tissues and/or conditions and match them to the genome sequence. d. Look for open reading frames by searching for stretches of DNA sequence without stop codons....
21. Double helix22. Repressor protein23. Adenine24. Ribosome.25. Promoter26. Replication27. RNA Polymerase.28. CodonA. Enzyme that synthesizes RNAB. Organelle where proteins are assembledC. Complementary to either Thymine or UracilD. mRNA sequence that codes for one amino acidE. Shape of double stranded DNAF. Sequence of DNA that controls gene expressionG. binds an operator and stops gene expression in LAC operon by preventing RNA polymerase from binding gene and transcribing. H. Duplication of DNA in 5 phase of Interphase
A gene point mutation that converts the sequence of the codon and therefore converts the encoded amino acid to a stop codon: missense mutation frameshift mutation silent mutation nonsense mutation A mouse gene was identified and determined to be required for formation of heart muscle. A gene with a similar sequence was identified in the human genome. What experiment could scientists do to determine if the mouse and human genes have similar functions? The scientist could place the mutant mouse...
What is a function of an AUG codon other than to start a new protein-coding sequence? Why is the nearly universal genetic code an indication that all of life had a single origin? How long would the mRNA need to be if it coded for a 150-amino-acid-long protein? Which codon position is most often responsible for the redundancy of the genetic code
For ss (+) RNA viruses, which protein is responsible for copying the genome? 1 the ribosome 2 the RNA-dependent RNA polymerase (RdRp) 3 DNA-dependent DNA polymerase 4 the reverse transcriptase
A DNA sequence that reads TAC CCC GAA will code for a protein with what ammo acid sequence? A. Met-Pro-Glu B. Tyr-Pro-Glu C. Tyr-Gly-Lcu D. Met-G I y-Leu E. Met-Pro-Lcu If the sequence on at RNA is UAC. then the sequence on the mRNA is: A. AUG B. UAC C.ATG D. CAUWhat happens at the "P" site on the ribosome? A. A peptide bond is formedB. A protein is released C. The ribosome prepares for translation D. There is no...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
lation stops when the ribosome A) Runs into a repressor protein B) Becomes stuck on an operator sequence c) Reaches a stop codorn D) All of the above E) B and C 28) The numerical notation for the correct reading frame i.... A) 0 B) 1 C) -1 D) +1 E) -10 29) What is the role(s) of chaperone proteins (chaperonins)? A) They assist the ribosome in binding to the beginning of mRNA. B) They properly fold nascent proteins into...
You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...