EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The...
- EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The strand is cut at the position of the apostrophe. The 50 base pair sequence shown below contains one or more EcoRI sites. Find them and circle them. Then count the resulting size (in base pairs – bp) of the DNA fragments (pieces) left over after using EcoRI to cut this DNA sequence.
Circle the EcoRI sites in the sequence below.
1- ggagaattcgctgtacgaggttaaccccgatgccATGGCATGAATTCGTG -50
List the sizes (in number of bases) of each fragment that would result from digestion with EcoRI.
Hint: Your total size of all your fragments should still produce a sum 50 bp. Bases are not removed when cut by a restriction enzyme.
Homework Answers
The fragment has two EcoRI restriction sites, shown in bold. The position where the DNA molecule will be cut is also indicated.
GGAG/AATTCGCTGTACGAGGTTAACCCCGATGCCATGGCATG/AATTCGTG
The fragments generated are:
4bp --> GGA
8bp --> AATTCGTG
38bp --> AATTCGCTGTACGAGGTTAACCCCGATGCCATGGCATG
Add Answer to:
EcoRI is a common restriction enzyme used in cloning
experiments. Its restriction sequence is G’AATTC. The...
One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
Question 4 C. Cloning and restriction enzyme digest Video aid 1: Plasmid cloning Video aid 2:...
Question 4
C. Cloning and restriction enzyme digest Video aid 1: Plasmid cloning Video aid 2: Restriction enzyme digest analysis The PCR was a success and your target region of 440 bp in length has been amplified. You igate a short linker containing an Apal restriction enzyme site onto both ends of the PCR product, digest it with Apal, and clone it into the Apal site of the 5 kb plasmid diagrammed below Bamll 300 EcoRI 3400 1000 2000 5...
2 Addendum 1 to this lab provides information on the location of the EcoRI, and Sspl...
2 Addendum 1 to this lab provides information on the location of the EcoRI, and Sspl cut sites in your BlueScript vector and the 1.3 kb EcoRI fragment. Using this information, (a) draw the two possible restriction maps for the recombinant pBlueKan plasmid that you constructed (see below). There are two possible maps because the 1.3 kb fragment could have been cloned in either orientation relative to the vector, Next, (b) predict the sizes of the EcoRI. and Sspl frements...
The following is a small part of a vector DNA sequence showing the NdeI and SacII...
The following is a small part of a vector DNA sequence showing
the NdeI and SacII cut sites. The
bases recognizedby the enzymes are in bold. They both are Class II
restriction enzymes. These enzymes recognize a specific sequence of
palindromic bases, i.e., reads the same on both strands
1. When you cut this DNA, shown in the figure above, by
NdeI, it will generate sticky ends. Write the two pieces
of DNA that will result after NdeI digestion and...
Restriction Mapping of a Linear DNA • 2 DNA is a linear and double-stranded DNA isolated...
Restriction Mapping of a Linear DNA • 2 DNA is a linear and double-stranded DNA isolated from bacteriophage lambda. This bacteriophage is a virus that infects E. coli and can undergo specialized transduction (see the transduction lab lecture). Assuming you obtained the following fragments from the restriction digestion. Draw the restriction map for the EcoRI and Hindi II enzymes in the 2. DNA. Fragment Size EcoRI 15300 6200 5250 2100 EcoRI + HindIII 15300 4400 4000 2100 1800 Hind!!! 17100...
If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site...
If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site of 5’GAATTC 3” and the cutting point between G and A. a. How many fragments you will get b. Specify the size (Number of bases) and the sequence of each fragment, pay attention to DNA direction (5’-3’) 5” ACATTGTCCGGGAATTC CGGGCTAGGCAT T GAATTGGAACA GAATTC GGGCCCGATCCGTA 3
please help me with these questions Lab 8 Extension Activity: Plasmid Mapping and Restriction Enzymes Mapping...
please help me with these questions
Lab 8 Extension Activity: Plasmid Mapping and Restriction Enzymes Mapping the Plasmid The first step in mapping a plasmid is to determine how many times a restriction site is found on that plasmid. Examine the results for plasmid 55 as an example. The data given in the following table are for the double digest using EcoRI and Pstl. Also, giving are the data for single digests by the individual enzymes. The numbers in the...
A linear DNA molecule that is 3250 bp long is digested with restriction enzyme A alone,...
A linear DNA molecule that is 3250 bp long is digested with restriction enzyme A alone, restriction enzyme B alone, or a combination of enzymes A and B to produce the following fragment sizes. Construct a restriction map of the DNA fragment. How many times does enzyme A cut the linear DNA molecule? If you are unable to place both enzymes A and B on the map, show one possible arrangement of enzyme A cognition sites on the DNA molecule.
A 10 kb linear DNA molecule was digested with restriction enzyme EcoRI (E) and two fragments...
A 10 kb linear DNA molecule was digested with restriction enzyme EcoRI (E) and two fragments were produced of sizes 6 kb and 4 kb. The restriction enzyme HaeIII (H) also produced two fragments of sizes 9 kb and 1 kb. When the two enzymes HaeIII and EcoRI were used together, three fragments were produced of sizes 1 kb, 3 kb, and 6 kb. A 4 kb long cloned genomic probe from this region hybridized to the 3 kb and...
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences...
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences in the PCR product most likely came from _______, and the restriction enzyme recognition sequences in the plasmid most likely came from ________. a. A multiple cloning site / the primers b. The primers / a multiple cloning site c. Both came from primers d. Both came from the multiple cloning site e. Naturally present in the gene of interest / the multiple cloning...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
Question 4
C. Cloning and restriction enzyme digest Video aid 1: Plasmid cloning Video aid 2: Restriction enzyme digest analysis The PCR was a success and your target region of 440 bp in length has been amplified. You igate a short linker containing an Apal restriction enzyme site onto both ends of the PCR product, digest it with Apal, and clone it into the Apal site of the 5 kb plasmid diagrammed below Bamll 300 EcoRI 3400 1000 2000 5...
2 Addendum 1 to this lab provides information on the location of the EcoRI, and Sspl cut sites in your BlueScript vector and the 1.3 kb EcoRI fragment. Using this information, (a) draw the two possible restriction maps for the recombinant pBlueKan plasmid that you constructed (see below). There are two possible maps because the 1.3 kb fragment could have been cloned in either orientation relative to the vector, Next, (b) predict the sizes of the EcoRI. and Sspl frements...
The following is a small part of a vector DNA sequence showing
the NdeI and SacII cut sites. The
bases recognizedby the enzymes are in bold. They both are Class II
restriction enzymes. These enzymes recognize a specific sequence of
palindromic bases, i.e., reads the same on both strands
1. When you cut this DNA, shown in the figure above, by
NdeI, it will generate sticky ends. Write the two pieces
of DNA that will result after NdeI digestion and...
Restriction Mapping of a Linear DNA • 2 DNA is a linear and double-stranded DNA isolated from bacteriophage lambda. This bacteriophage is a virus that infects E. coli and can undergo specialized transduction (see the transduction lab lecture). Assuming you obtained the following fragments from the restriction digestion. Draw the restriction map for the EcoRI and Hindi II enzymes in the 2. DNA. Fragment Size EcoRI 15300 6200 5250 2100 EcoRI + HindIII 15300 4400 4000 2100 1800 Hind!!! 17100...
please help me with these questions
Lab 8 Extension Activity: Plasmid Mapping and Restriction Enzymes Mapping the Plasmid The first step in mapping a plasmid is to determine how many times a restriction site is found on that plasmid. Examine the results for plasmid 55 as an example. The data given in the following table are for the double digest using EcoRI and Pstl. Also, giving are the data for single digests by the individual enzymes. The numbers in the...
A linear DNA molecule that is 3250 bp long is digested with restriction enzyme A alone, restriction enzyme B alone, or a combination of enzymes A and B to produce the following fragment sizes. Construct a restriction map of the DNA fragment. How many times does enzyme A cut the linear DNA molecule? If you are unable to place both enzymes A and B on the map, show one possible arrangement of enzyme A cognition sites on the DNA molecule.
Most questions answered within 3 hours.
-
3) What are the typical social structures in a global city?
asked 2 hours ago -
Luther Corporation
Consolidated Balance Sheet
December 31, 2019 and 2018 (in $ millions)
Assets
2019
2018...
asked 2 hours ago -
(Expected rate of return and risk) Carter Inc. is evaluating a
security. Calculate the investment’s expected...
asked 5 hours ago -
What specific indicators can point to lack of progress for
African Americans in American society?
asked 6 hours ago -
1-The Electrons in a beam are moving at 2.7×108 m/s in an
electric field of 15000...
asked 6 hours ago -
A gas tank is a vertical cylinder. It has a radius of 1m, a
height of...
asked 7 hours ago -
Accent Software faces the following conditions. All of these
support Accent’s use of a market-penetration pricing...
asked 8 hours ago -
A mathematically inclined friend emails you the following
instructions: "Meet me in the cafeteria the first...
asked 8 hours ago -
A monopoly sells in two countries . The demand curves in the two
countries are p1...
asked 9 hours ago -
A .15kg rubber ball is bounced off a wall. Before hitting the
wall, the ball moves...
asked 9 hours ago -
A manufacturing company preparing to build a new plant is
considering three potential locations for it....
asked 9 hours ago -
B. If compound Y has approximately the same values of solubility
in toluene as compound X,...
asked 10 hours ago