If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site...
Homework Answers
Answer:
There are two restriction enzyme cut sites for the target 5' GAATTC 3', in the given DNA sequence
5” ACATTGTCCGGGAATTC CGGGCTAGGCAT T GAATTGGAACA GAATTC GGGCCCGATCCGTA 3
As a rule, if in a linear DNA there are two recognition sites for a restriction enzyme, there will be N +1 fragments.
(1) Therefore, there will be 3 DNA fragment produced
(2) The length of the DNA fragment with sequence are
(i) ACATTGTCCGGG (12 nucleotides)
(ii) AATTC CGGGCTAGGCAT T GAATTGGAACA G (30 nucleotides)
(iii) AATTC GGGCCCGATCCGTA (19 nucleotides)
Add Answer to:
If
you cut the following single stranded DNA fragment with a
restriction enzyme with restriction site...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
5. If you are digesting a large linear fragment that is 300,000 bp in length. How...
5. If you are digesting a large linear fragment that is 300,000 bp in length. How many fragments would be produced if the DNA was digested by the following enzymes? Assume the fragment sizes are the average sizes calculated for a random DNA sequence. Use the information in the table from Question 3. Show your work. (A) Smal (B) Haelll (C) Noti Table 4.1 Recognition Sequences and Cutting Sites of Selected Restriction Endonucleases Enzyme Alul BamHI Bgli Clal ECORI Haelll...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...
EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The...
EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The strand is cut at the position of the apostrophe. The 50 base pair sequence shown below contains one or more EcoRI sites. Find them and circle them. Then count the resulting size (in base pairs – bp) of the DNA fragments (pieces) left over after using EcoRI to cut this DNA sequence. Circle the EcoRI sites in the sequence below. 1- ggagaattcgctgtacgaggttaaccccgatgccATGGCATGAATTCGTG -50 List...
Restriction Mapping of a Linear DNA • 2 DNA is a linear and double-stranded DNA isolated...
Restriction Mapping of a Linear DNA • 2 DNA is a linear and double-stranded DNA isolated from bacteriophage lambda. This bacteriophage is a virus that infects E. coli and can undergo specialized transduction (see the transduction lab lecture). Assuming you obtained the following fragments from the restriction digestion. Draw the restriction map for the EcoRI and Hindi II enzymes in the 2. DNA. Fragment Size EcoRI 15300 6200 5250 2100 EcoRI + HindIII 15300 4400 4000 2100 1800 Hind!!! 17100...
Which of the following shows a double-stranded segment of DNA that might be cut by a...
Which of the following shows a double-stranded segment of DNA that might be cut by a restriction enzyme? 5’ GACTGACT 3’ 3’ CTGACTGA 5’ 5’ GAGGAG 3’ 3’ CTCCTC 5’ 5’ GAATTC 3’ 3’ CTTAAG 5’
7. Decide whether the DNA fragment shown below will be cut by the following restriction endonucleases:...
7. Decide whether the DNA fragment shown below will be cut by the following restriction endonucleases: EcoRI (5’-GAATTC-3’), AluI (5’-AGCT-3’), PstI (5’-CTGCAG-3’). For each one that cuts, how many products will be produced? 5’-AAGAATTGCGGAATTCGAGCTTAAGGGCCGCGCCGAAGCTTTAAA-3’ 3’-TTCTTAACGCCTTAAGCTCGAATTCCCGGCGCGGCTTCGAAATTT-5’
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this...
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this plasmid into two fragments. A. True B. False 2.In general, restriction enzymes that recognize four nucleotides have higher probability to produce more DNA fragments than those enzymes that recognize six nucleotides. A. true B. false 3. Which of the following sequences are palindromes? A. 5' TGGCCA 3' B. 5' GAAAAG 3' C. 5' CGATGG 3' D. 5' GACGAC 3' 4. Below are the possible...
3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut...
3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut with the restriction enzyme BamH1 and ligated into a plasmid that was also cut with BamH1. You have denatured the DNA and annealed a labeled primer to plasmid sequences adjacent t<o the insertion site as shown below: 3' BamHi 5' GATCTAGCTAGCTAGCTAGCTAGCTAGCTAGCCATCGATGCTAGGAATCTTTGCTGATGCTAGTCGATGCCGTAGC ACTACGATCAGCTACGGC 3' 18 base primer 5' Next you add DNA polymerase, buffer, an excess of all four dNTPs, and a small amount of...
Suppose you digest the genomic DNA of a particular organism with the restriction enzyme SauA. Then...
Suppose you digest the genomic DNA of a particular organism with
the restriction enzyme SauA. Then you ligate the resulting fragment
into a unique BamHI cloning site of a plasmid. The sequence of the
restriction sites and position of cleavage is shown below
Note: X and Y and their complementary bases Z and Y’
respectively can be any base (A,C, G, or T)
1) As you can see, ligation is possible because the two restriction
enzymes produce compatible sticky ends....
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
5. If you are digesting a large linear fragment that is 300,000 bp in length. How many fragments would be produced if the DNA was digested by the following enzymes? Assume the fragment sizes are the average sizes calculated for a random DNA sequence. Use the information in the table from Question 3. Show your work. (A) Smal (B) Haelll (C) Noti Table 4.1 Recognition Sequences and Cutting Sites of Selected Restriction Endonucleases Enzyme Alul BamHI Bgli Clal ECORI Haelll...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...
Restriction Mapping of a Linear DNA • 2 DNA is a linear and double-stranded DNA isolated from bacteriophage lambda. This bacteriophage is a virus that infects E. coli and can undergo specialized transduction (see the transduction lab lecture). Assuming you obtained the following fragments from the restriction digestion. Draw the restriction map for the EcoRI and Hindi II enzymes in the 2. DNA. Fragment Size EcoRI 15300 6200 5250 2100 EcoRI + HindIII 15300 4400 4000 2100 1800 Hind!!! 17100...
3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut with the restriction enzyme BamH1 and ligated into a plasmid that was also cut with BamH1. You have denatured the DNA and annealed a labeled primer to plasmid sequences adjacent t<o the insertion site as shown below: 3' BamHi 5' GATCTAGCTAGCTAGCTAGCTAGCTAGCTAGCCATCGATGCTAGGAATCTTTGCTGATGCTAGTCGATGCCGTAGC ACTACGATCAGCTACGGC 3' 18 base primer 5' Next you add DNA polymerase, buffer, an excess of all four dNTPs, and a small amount of...
Suppose you digest the genomic DNA of a particular organism with
the restriction enzyme SauA. Then you ligate the resulting fragment
into a unique BamHI cloning site of a plasmid. The sequence of the
restriction sites and position of cleavage is shown below
Note: X and Y and their complementary bases Z and Y’
respectively can be any base (A,C, G, or T)
1) As you can see, ligation is possible because the two restriction
enzymes produce compatible sticky ends....
Most questions answered within 3 hours.
-
This is QA Tester's task
What was the most heinous bug that you let slip through?...
asked 3 minutes ago -
What is the chemical equation (with states) for this
reaction in balanced and unbalanced form?
In...
asked 7 minutes ago -
In engineering and product design, it is important to consider
the weights of people so that...
asked 12 minutes ago -
The first-order decomposition of N2O5 at 328 K has a rate
constant of 1.70 × 10-3...
asked 14 minutes ago -
Do you believe that some things that fall into the category of
“pseudoscience” are worth believing...
asked 36 minutes ago -
A 0.100-kg, 59.6-cm-long uniform bar has a small 0.070-kg mass
glued to its left end and...
asked 28 minutes ago -
Direct Labor Variances
The following data relate to labor cost for production of 4,600
cellular telephones:...
asked 42 minutes ago -
On July 27, 2018, shareholders of the Walt Disney Company and
21st Century Fox agreed to...
asked 20 minutes ago -
Write a brief response, 30-90-words, for each question below. 1.
In your own words, define “Auditing.”...
asked 25 minutes ago -
Water flows through a 8-foot wide and 4-foot tall rectangular
channel. If the desired flow rate...
asked 33 minutes ago -
Cruz Video Center accumulates the following cost and net
realizable data at December 31.
Cameras $14,700...
asked 37 minutes ago -
1. Describe the differences between management in the nonprofit
sector and management in other sectors. How...
asked 43 minutes ago