Which of the following shows a double-stranded segment of DNA that might be cut by a restriction enzyme? 5’ GACTGACT 3’ 3’ CTGACTGA 5’ 5’ GAGGAG 3’ 3’ CTCCTC 5’ 5’ GAATTC 3’ 3’ CTTAAG 5’
Restriction enzymes recognize and bind to specific sequences of
DNA. When it finds its target sequence, a restriction enzyme will
make a double-stranded cut in the DNA molecule. As an example of
how a restriction enzyme recognizes and cuts at a DNA sequence,
let's consider EcoRI, a common restriction enzyme used in labs.
EcoRI cuts at the following site:
5'-GAATTC-3'
3'-CTTAAG-5'
So the double-stranded segment of DNA 5’ GAATTC-3' would be cut by the restriction enzyme.
Which of the following shows a double-stranded segment of DNA that might be cut by a...
If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site of 5’GAATTC 3” and the cutting point between G and A. a. How many fragments you will get b. Specify the size (Number of bases) and the sequence of each fragment, pay attention to DNA direction (5’-3’) 5” ACATTGTCCGGGAATTC CGGGCTAGGCAT T GAATTGGAACA GAATTC GGGCCCGATCCGTA 3
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
15. Which one represents the correct DNA molecule based on the double helix model?A. 5'-GAATTC-3' 5'-GAATTC-3'B. 5'-GAATTC-3' 3'-GAATTC-5'C. 5'-GAATTC-3' 5'-CTTAAG-3'D. 5'-GAATTC-3' 3'-CTTAAG-5'E. 5'-GAAUUC-3' 3'-CUUAAG-5'16. In the flow of genetic information (often called the Central Dogma), which of the following best represents the expression of genes? A. Protein—>RNA—>DNA B. DNA—>RNA—>Protein C. RNA—>DNA—>Protein D. DNA—>Protein—>RNAE. RNA—>Protein—>DNA17. Which of the following double-stranded nucleic acid represents the double helix model that is based on the two main concepts, antiparallel orientation and base-pairing rule, suggested by...
What solution is used to isolate the DNA from the bacterial cells 7. Alkaline lysis buffer b Acidic lysis buffer RNase C d None of the above 8 What solution is used to isolate the DNA from the spin column? DNA buffer a. b. Elution buffer P1 c. d. P2 9 EcoRI restriction site is 5' GAATTC 3' and 3' CTTAAG 5 a 5' GAATTC 3' and 3' CTTAAG 5 b 5' GAATTC 3' and 3' CTTAAG 5 C. d....
Part A
Which model shows the correct polarity of double-stranded
DNA?
Which model shows the correct polarity of double-stranded
DNA?
Part B
Which model shows the correct polarity between mRNA and the DNA
template during transcription?
Which model shows the correct polarity between mRNA and the DNA
template during transcription?
Part C
Which model shows the correct polarity between mRNA and tRNA
during translation?
Which model shows the correct polarity between mRNA and tRNA
during translation?
Part D
Interpret this...
A PCR reaction begins with 5 double stranded segment(s) of DNA. Part A: Estimate the number of double-stranded copies of DNA that are present after the completion of 15 amplification cycles? Part B: After 30 cycles?
please answer and explain each answer
(2 points). Which of the following is cut by restriction enzymes? a. Double-stranded DNA b. Double stranded RNA c. Single-stranded DNA d. Single-stranded RNA (2 points). Which of the following is cut by Dicer? a. Double-stranded DNA b. Double stranded RNA d. Single-stranded RNA c. Single-stranded DNA
DNA fragments cut by most restriction enzymes have: double-stranded complementary ends. either only sequences of Gs or only sequences of Cs. cuts made at random points along one of the strands. protruding sticky ends.
The table shows where different restriction endonucleases (restriction enzymes) cleave DNA. The abbreviation R represents the purines (adenine and guanine). The pyrimidines (cytosine, thymine, and uracil) are abbreviated as Y. The abbreviation W represents adenine or thymine. Enzyme EcoRI EcoRV Target sequence 5' GAATTC 3 3' CTTAAG 5 5' GATATC 3 3' CTATAG 5 5' GGCC 3' 3' CCGG 5 5' AAGCTT 3 3' TTCGAA 5 5' RGGWCCY 3 3' YCCWGGR 5 Cleavage 5G AATTC 3' 3' CTTAA G 5'...
Which protein binds to single-stranded DNA, allowing the single-stranded DNA to invade a double-stranded DNA double helix with sequence homology? O A. RecA OB. RecB OC. Single-stranded DNA binding protein OD. Recc O E. RecD