Question

What solution is used to isolate the DNA from the bacterial cells 7. Alkaline lysis buffer b Acidic lysis buffer RNase C d None of the above 8 What solution is used to isolate the DNA from the spin column? DNA buffer a. b. Elution buffer P1 c. d. P2 9 EcoRI restriction site is 5' GAATTC 3' and 3' CTTAAG 5 a 5' GAATTC 3' and 3' CTTAAG 5 b 5' GAATTC 3' and 3' CTTAAG 5 C. d. None of the above 10. You have a double stranded DNA sequence. One of the strands sequence is 5' GAATTCTATAGAATTCTATAGAATTC 3'. How many times would EcoRI cut this piece of DNA? Two times a. b. Four times Six times C. d. Eight times 11. What verification method would be used to confirm that your DNA has been cut by Eco RI? Plasmid miniprep а. Gel Electrophoresis c. Transformation d. Transfection 12. How does the DNA travel through the gel during electrophoresis? Size and charge a. b. charge size C. none of the above d.

Answer 1

7. Alkaline lysis

The principal of this technique of DNA isolation is to first break down the cell membrane and then nuclear membrane to take the DNA out from the nucleus. Then and precipitate all the biological macromolecules and membrane fragments so that DNA becomes soluble in the aqueous phase. Then precipitate out the DNA from by phase by addition of chilled ethanol.

8. Elution buffer

We isolate DNA from the spin column by addition of elution buffer. After the addition of this buffer DNA is centrifuged with a very high speed, which makes all the cell debreis to settle at the bottom and then DNA can be extracted from the elution buffer.

9. A

Fact to remember
10. All options are incorrect.
Answer is 3 times

11. B

Gel electrophoresis is a technique key used for the separation of DNA molecules on the basis of their charge and size with the application of an external electric field.

When we isolate DNA from an organism, then due to its delicate nature it may get fragmented in the isolation process. Due to this fragmentation, when we separate it using gel electrophoresis, we are able to see a number of fragments on the gel. Hence we get a prove that our DNA has been isolated.

12. A

The movement of DNA on the gel of gel electrophoresis is due to the size and charge of the DNA. DNA molecules and negatively charged due to presence of negatively charged phosphate group so they move towards positively charged anode.

Small the size of DNA molecule lesser will be its ability to travel on the gel. So in the starting of the gel, weare able to see large sized molecules and at the bottom of the gel we can see small sized molecules.

please rate.