A PCR reaction begins with 5 double stranded segment(s) of DNA. Part A: Estimate the number...
A PCR reaction begins with 5 double stranded segment(s) of DNA.
Part A:
Estimate the number of double-stranded copies of DNA that are present after the completion of 15 amplification cycles?
Part B:
After 30 cycles?
Homework Answers
The number of double stranded DNA pieces is doubled in each cycle , so that after "n" cycles you have 2^n(2 to the power n).
Keeping this in mind let's go the answer
Part A.
After 15 amplification the number of double stranded copies of DNA will be equal to 2^15 that is 32,768.
Since they start with 5 DNA segment it will be 32,768 x 5= 1,63,840.
Part B
Similarly, 2^30 =1,073,741,824
With having 5 DNA segment after 30 amplification cycles = 5x1,073,741,824
= 5,368,709,120
Add Answer to:
A PCR reaction begins with 5 double stranded segment(s) of
DNA.
Part A:
Estimate the number...
1.The PCR (polymerase chain reaction) protocol that is currently used in laboratories was facilitated by the...
1.The PCR (polymerase chain reaction) protocol that is currently
used in laboratories was facilitated by the discovery of a
bacterium called Thermus aquaticus in a hot spring inside
Yellowstone National Park, in Wyoming. This organism contains a
heat-stable form of DNA polymerase known as Taq
polymerase, which continues to function even after it has been
heated to 95°C.
a.Why would such a heat-stable polymerase be beneficial in
PCR?
b.What would happen if it weren’t
heat stable?
c.How might you choose...
Suppose you start a PCR reaction with 3 copies of a double stranded DNA fragment. How...
Suppose you start a PCR reaction with 3 copies of a double stranded DNA fragment. How many copies will be present after 4 replication cycles? a. 7 b. 64 c. 48 d. 24 e. 8
Q1 The immediate template for PCR amplification is double stranded DNA. (True or False) Q2 A...
Q1 The immediate template for PCR amplification is double stranded DNA. (True or False) Q2 A primer is a DNA oligonucleotide. (True or False) Q1 Denaturation of DNA double helix takes place at 96 C. (True or False) Q2 A primer is a single stranded DNA oligonucleotide. (True or False) Q1 16 doubled stranded DNA fragments are obtained from one DNA double stranded template after 4 cycles of PCR. (True or False) Q2 Denaturation of DNA double helix takes place...
2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exp...
2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exponentially (1-2-4-8-etc) after each cycle. The number of cycles we used is on page 97. What is the number of copies of the 303 bp fragment that will theoretically be present at the end of our reaction? b. Denaturation of the 303 bp segment of the TAS2R38 gene is a critical first step in the PCR perties of a DNA segment that...
1. Explain why, when PCR is used to amplify the same region of DNA from two...
1. Explain why, when PCR is used to amplify the same region of DNA from two different people, the size of the DNA fragment(s) generated may be different? 2. What characteristic of the DNA molecule makes it possible to use electrophoresis to separate DNA molecules by size? Explain why this characteristic is important for electrophoresis and what part of the DNA molecule creates this characteristic. 3. You are performing PCR. After four cycles of PCR, how many double-stranded copies of...
1. What are the degenerate primers in the PCR amplification protocol? What do they do? 2....
1. What are the degenerate primers in the PCR amplification protocol? What do they do? 2. Suppose you begin a PCR reaction with 1 piece of double stranded DNA. After 30 cycles of replication, how many pieces of double stranded DNA do you now have? 3. What would be the consequence of having too much DNA in the sample? Would it interfere with the PCR reaction? Why? 4. What happens during the annealing step of the PCR reaction? During the...
The following double stranded segment of DNA is part of a protein coding gene. The segments...
The following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. GCTAAATGGCAaaattgccggatgacGCACATTGACTCG Gaatcga GGTCAGATGC CGATTTACCGTtttaacggcctact CGTGTA ACTGAGCCttagctCCAGTCTACG write-out: The sequence of the primary transcript: The mature mRNA resulting from this stretch of DNA:
Now. you should be able to answer the following questions: • How the amplification will be...
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
Below is a sequence of double-stranded DNA that will be used as a template in the...
Below is a sequence of double-stranded DNA that will be used as a template in the polymerase chain reaction (PCR). The goal is to use this as a template to make a a PCR product that includes the shaded area. The sequence of one of the PCR primers is given below. Template DNA: 5' - CTTAGCGCTGTTGGGGGCCAACTATCACACACACCACACACAGGTATAAATGGCATTTGATACAGATTG - 3' 3' - GAATCTGTATCAAATGCCATTTATACCTGTGTGTGGTGTGTGTGATAGTTGGCCCCCAACAGCGCTAAG - 5' If the sequence of one of the primers is 5' TTGTGGGGCC 3' which of the following primers...
Consider a standard PCR reaction. If instead of including double-stranded DNA from a biological sample, you ...
Consider a standard PCR reaction. If instead of including double-stranded DNA from a biological sample, you added mRNA molecules from a biological sample, the reaction would… Can you please explain why the answer is not E A. work, but would yield less product because you started off with single-stranded template B. A and D are correct C. work, but would generate much shorter products D. not work because you would also need to replace the dNTPs with NTPs for the...
1.The PCR (polymerase chain reaction) protocol that is currently
used in laboratories was facilitated by the discovery of a
bacterium called Thermus aquaticus in a hot spring inside
Yellowstone National Park, in Wyoming. This organism contains a
heat-stable form of DNA polymerase known as Taq
polymerase, which continues to function even after it has been
heated to 95°C.
a.Why would such a heat-stable polymerase be beneficial in
PCR?
b.What would happen if it weren’t
heat stable?
c.How might you choose...
2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exponentially (1-2-4-8-etc) after each cycle. The number of cycles we used is on page 97. What is the number of copies of the 303 bp fragment that will theoretically be present at the end of our reaction? b. Denaturation of the 303 bp segment of the TAS2R38 gene is a critical first step in the PCR perties of a DNA segment that...
1. What are the degenerate primers in the PCR amplification protocol? What do they do? 2. Suppose you begin a PCR reaction with 1 piece of double stranded DNA. After 30 cycles of replication, how many pieces of double stranded DNA do you now have? 3. What would be the consequence of having too much DNA in the sample? Would it interfere with the PCR reaction? Why? 4. What happens during the annealing step of the PCR reaction? During the...
The following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. GCTAAATGGCAaaattgccggatgacGCACATTGACTCG Gaatcga GGTCAGATGC CGATTTACCGTtttaacggcctact CGTGTA ACTGAGCCttagctCCAGTCTACG write-out: The sequence of the primary transcript: The mature mRNA resulting from this stretch of DNA:
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
Most questions answered within 3 hours.
-
Suppose, for any future year, the probability its October rain
is more than 3 inches is...
asked 42 seconds ago -
Solve the following systems of linear equations using
substitution 12p + 3q = 15 6q +...
asked 7 minutes ago -
Prof. D went grocery shopping and purchased one dozen eggs and
one pound of flour (all...
asked 15 minutes ago -
If
somehow loop of Henle were removed - that is if the proximal tubule
was connected...
asked 15 minutes ago -
Add 1ml of 0.18M of HCl (aq) to 1ml of 0.2M of [Ag(NH3)2]Br
(aq).
Write the...
asked 22 minutes ago -
1. Smoke detectors use Am-241, an alpha emitter, to detect smoke
particles. A parent is concerned...
asked 26 minutes ago -
Scenario: Web application developed to capture customers
demographic and financial information for filling their taxes. This...
asked 30 minutes ago -
Which of the following statements are true?
1. Glass is mostly silicon dioxide and so when...
asked 52 minutes ago -
Korman Company has the following securities in its portfolio of
equity securities on December 31, 2018:...
asked 53 minutes ago -
Using the 12th edition of Language Awareness,
complete the following assignment:
After reading Akiba Solomon's "Thugs....
asked 1 hour ago -
For all problems assume an effective monthly interest rate of 1%
unless otherwise indicated in the...
asked 1 hour ago -
Fix all syntax and logical errors for the following program.
Please generate the correct output. //...
asked 1 hour ago