Consider a standard PCR reaction. If instead of including double-stranded DNA from
a biological sample, you added mRNA molecules from a biological sample, the reaction
would… Can you please explain why the answer is not E
A. work, but would yield less product because you started off with single-stranded
template
B. A and D are correct
C. work, but would generate much shorter products
D. not work because you would also need to replace the dNTPs with NTPs for the
reaction to work
E. not work because the enzyme will not have the type of template it needs
Ans cannot be option E because Taq DNA Polymerase has an intrinsic RNA-dependent DNA polymerase activity (reverse transcriptase activity). However, this activity is very low and mRNA needs to be present in large quantity.
Amount of Product will be less .
Consider a standard PCR reaction. If instead of including double-stranded DNA from a biological sample, you ...
Suppose you start a PCR reaction with 3 copies of a double stranded DNA fragment. How many copies will be present after 4 replication cycles? a. 7 b. 64 c. 48 d. 24 e. 8
Below is a sequence of double-stranded DNA that will be used as a template in the polymerase chain reaction (PCR). The goal is to use this as a template to make a a PCR product that includes the shaded area. The sequence of one of the PCR primers is given below. Template DNA: 5' - CTTAGCGCTGTTGGGGGCCAACTATCACACACACCACACACAGGTATAAATGGCATTTGATACAGATTG - 3' 3' - GAATCTGTATCAAATGCCATTTATACCTGTGTGTGGTGTGTGTGATAGTTGGCCCCCAACAGCGCTAAG - 5' If the sequence of one of the primers is 5' TTGTGGGGCC 3' which of the following primers...
Eliminating which of the following from a PCR reaction would result in no amplification of DNA? a) template DNA b) primers c) Taq Polymerase d) dNTPs e) Eliminating any of these would result in no amplification of DNA
A PCR reaction begins with 5 double stranded segment(s) of DNA. Part A: Estimate the number of double-stranded copies of DNA that are present after the completion of 15 amplification cycles? Part B: After 30 cycles?
20. Which enzyme separates the strands of the DNA helix? A. DNA Polymerase E. Single Stranded Binding Proteins B. Ligase F. Primase C. Helicase G. Lagging Strand D. Topoisomerase H. Leading Strand 21. Which enzyme joins newly synthesized DNA fragments on the lagging strand? A. DNA Polymerase E. Single Stranded Binding Proteins B. Ligase F. Primase C. Helicase G. Lagging Strand D. Topoisomerase H. Leading Strand 22. In a PCR reaction, at which temperature do the two strands of DNA...
1) If a restriction enzyme cuts a circular DNA into five fragments, how many restriction sites are there in the DNA? 2) How many molecules of DNA will be present after 6 cycles of PCR, if you started with one double-stranded DNA molecule? CELL BIOLOGY QUESTIONS!! SHOW WORK PLEASE
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
As described above, prior to a primer extension reaction, a solution containing the primer and double stranded template DNA are heated to 95 degree C and then cooled back to room temperature. Why is this step necessary Would it matter if you added the dNTPs or DNA polymerase before or after this step? Why or why not?
To be able to clone a intron free gene from E. coli using PCR, you would need to use ____ as template. A. cDNA generated from E. coli B. chromosomal DNA C. Chromosomal DNA or cDNA, because the bacteria does not have introns D. mature mRNA
Which is not one of the elements needed to amplify DNA by polymerase chain reaction (PCR)? Question 16 options: A) Nucleoside triphosphates that serve as the source of the nucleotides A, T, C, and G needed in the synthesis of the new strands of DNA B) A restriction endonuclease enzyme that cleaves DNA at specific locations C) The segment of DNA that must be copied D) A DNA polymerase enzyme that will catalyze the synthesis of a complementary strand of...