Question

You isolate three E. coli mutants that are unable to synthesize histidine. You amplify the gene responsible for the phenotype

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Gel electrophoresis is a technique used to separate DNA fragments according to their size. DNA samples are loaded into wells at one end of a gel, and an electric current is applied to pull them through the gel. DNA fragments are negatively charged, so they move towards the positive electrode. Thus largest fragments will be heavier and remain on the top and lighter fragments will move lastly and come to the bottom. On this basis fragment number 1 is lightest as it is moving very fast and is near the bottom so this fragment has suffered a deletion I.e loss of nucleotides.

Add a comment
Know the answer?
Add Answer to:
You isolate three E. coli mutants that are unable to synthesize histidine. You amplify the gene...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Please answer both parts a and b. Please explain your answer. (The marked answers in the...

    Please answer both parts a and b. Please explain your answer. (The marked answers in the pictures are incorrect!) a) b) What are the 5 base pair primer sequences required to amplify the central region of the following template, such that the final PCR product will have a length of 20 nucleotides? 3' AGCTTGTCCAGTGGTCAGAGTCAGTAGCCGTAGG 5' Select one: O a. 5' CCAGT 3' and 5'CTACT 3' b. 5' GATGA 3' and 5' GGTCA 3' O O C.5'GAACA 3' and 5' ATGCC...

  • Below is a set of experiments for cloning the human growth hormone (HGH) gene and then...

    Below is a set of experiments for cloning the human growth hormone (HGH) gene and then expressing the HGH protein in E. coli starting from human pituitary glands and a tube of plasmid vector DNA. The plasmid expression vector contains the arabinose inducible expression system. Specify the correct order for carrying out these experiments, using the letter codes in front of each procedure. Use all of the steps in your answer, except for one step that should NOT be included....

  • 2. You have identified a mutant E. coli strain that cannot synthesize histidine (His). To determine...

    2. You have identified a mutant E. coli strain that cannot synthesize histidine (His). To determine the location of the his mutation on the E. coli chromosome, you perform interrupted mating experiments with 5 different Hfr strains. The following chart shows the time of entry (minutes, in parentheses) of the wild-type alleles of the first 5 markers (mutant genes) into the His strain. + + Hfr A. Hfr B Hfr CH Hfr D. Hfr E- his (3) cys (11)- arg...

  • QUESTION 7 Imagine you discovered a strain of E. coli lacking a gene necessary to synthesize...

    QUESTION 7 Imagine you discovered a strain of E. coli lacking a gene necessary to synthesize the amino acid histidine (they are therefore his). You attempt to rescue the cells by transforming them DNA from a wild-type his "donor" strain, and you plate your transformed sample and all controls on plates lacking histidine (-His) as well as plates containing histidine (+His). Shown below are the results of your transformation. + indicates there was growth, and - indicates there was no...

  • you have isolated spontaneous mutations in the LEU6 gene of a haploid strain of the yeast...

    you have isolated spontaneous mutations in the LEU6 gene of a haploid strain of the yeast S. cerevisiae. Some of your mutations result in a complete loss of LEU6 gene function. You reason that this phenotype may be due to insertion of a mobile DNA element into the gene. To test this idea, you sequence the LEU6 region ion from several of your mutants and compare the DNA to the previously determined sequence for LEU6 in the parental strain. Numerous...

  • As a student project, you have isolated six new mutant strains of E. coli with altered...

    As a student project, you have isolated six new mutant strains of E. coli with altered behavior of the lactose operon. The strains are listed in the table below, together with their phenotypes (with regard to significant ?-galactosidase synthesis) in three specific situations. Columns 1 and 2 present the phenotypes of each mutant haploid strain. In column 1, the mutant is in an otherwise wild-type genome. In column 2, the genome also carries a nonsense-suppressor mutation (that is not present...

  • A1. The following is the DNA sequence of a hypothetical gene for the SMALL protein. It...

    A1. The following is the DNA sequence of a hypothetical gene for the SMALL protein. It is called the SMALL gene. i atgggattac actgtcacga ccaaatagcc ttcattgtat 41 caaaaggato aatcgagtta tag Imagine you are doing a research project in a laboratory and your supervisor asks you to clone the SMALL gene into the PBR322 plasmid (shown below). You must use the Pstl and EcoRI sites for your cloning. HindIII EcoRI | EcoRV BamHI 4359 0 29 185 4000 375 Sall Psti...

  • You are using PCR to amplify a 300 bp target sequence, a portion of Gene X,...

    You are using PCR to amplify a 300 bp target sequence, a portion of Gene X, from human genomic DNA isolated from patients' blood samples. The instructions for this procedure tell you to include Samples A and B, whose contents are listed below, with each batch of patient samples that you run. Ingredients Sample A Sample B 10x PCR Buffer (Tris,KCI,MgCl2,BSA) 5 mL 5 mL H2O 37.8mL 38.8mL dNTP's 3 mL 3 mL Taq DNA polymerase 0.2 mL 0.2 mL...

  • These are previous exam questions I am just preparing for the final exam by studying the...

    These are previous exam questions I am just preparing for the final exam by studying the previous questions! please help me out! A1. The following is the DNA sequence of a hypothetical gene for the SMALL protein. It is called the SMALL gene. 1 atgggattac actgtcacga ccaaatagcc ttcattgtat 41 caaaaggatc aatcgagtta tag Imagine you are doing a research project in a laboratory and your supervisor asks you to clone the SMALL gene into the pBR322 plasmid (shown below) You must...

  • 3. (7) Suppose that you have selected E. coli that can grow only when the medium...

    3. (7) Suppose that you have selected E. coli that can grow only when the medium is supplemented with cysteine. You isolate one mutant that you believe is defective in a new gene require for cysteine biosynthesis - cysX . You have two strains of bacteria: Hfr cysX - gal+ his+ lac+ pur+ trp+ ton s F - cysX+ gal - his - lac - pur - trp - ton R A) What supplements would you need to add to...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT