Homework Answers
I believe the correct answer to be:
Option E) 64.
As possible combinations are number of possible nucleotide to the power number of available locations:
43 = 64.
But in reality there are only 61 that code for amino acids and 3 are stop codons that do not code for anything.
feel free to leave a comment down below for any further query. good rating would be appreciated if you find my answer helpful. thank you.
Add Answer to:
help!
Question 9 1.3 pts of codons that code for 20 amino acids? 16 600 60
Question 5 -- / 1 There are different amino acids, and possible codons. 1 3; 20...
Question 5 -- / 1 There are different amino acids, and possible codons. 1 3; 20 2 3; 64 3 20; 3 4) 20; 64 5) 64; 3 6 64; 20 Question 6 -- / 1 Which of the following contains an open reading frame (consider the given strand only)? 1 AUGCCCGGGCGAGAC UAUGCGCAACCUGAG N 3 AAAUGAUGACCCAAA 4 UAUGCCGUCGUGAGG 5 UGAUUUCCCGGGCAA Which of the following is true? The initiator tRNA starts in the A site of the ribosome during translation initiation,...
Question 8 2.5 pts If a protein (polypeptide) is composed of 210 amino acids, how many...
Question 8 2.5 pts If a protein (polypeptide) is composed of 210 amino acids, how many mRNA codons would be required? Question 9 2.5 pts If a protein (polypeptide) is composed of 210 amino acids, how many mRNA ribonucleotides would be required?
The genetic code is considered degenerate because most amino acids are encoded by at least two...
The genetic code is considered degenerate because most amino acids are encoded by at least two different codons. Some researchers have hypothesized that during evolution the genetic code has been optimized for its intended use in different organisms. Reseachers can study this by examining the relationship between the frequency with which an amino acid appears in all the proteins in an organism and the total number of codons for an amino acid. An optimized organism would use amino acids in...
Question 36 The genetic code is a listing that gives the relationship between? O codons and...
Question 36 The genetic code is a listing that gives the relationship between? O codons and amino acids O codons and anticodons codons and genes anticodons and genes Question 37 A human cell normally contains how many chromosomes?
Problems 1) Look at the structure of the natural amino acids (look them up). What do the 8 primordial amino acids have in common (generally)? What do you notice about the ones with 2 or fewer codons?...
Problems 1) Look at the structure of the natural amino acids (look them up). What do the 8 primordial amino acids have in common (generally)? What do you notice about the ones with 2 or fewer codons? 2) Calculate the actual information content per amino acid of protein translation by using the genetic code and the fact that in nature, the frequency of U and C is 22%, A is 30% and G is 26%. Finally, since 3 of 64...
U Question 9 1 pts The following Kekule structure is one of 20 essential amino acids...
U Question 9 1 pts The following Kekule structure is one of 20 essential amino acids found in the human body. Determine its chemical formula. Y OH NH2 Enter the formula without any spaces in the following format: CxH,OzNw
The genetic code___ Enables combinations of nucleotides to code for the 20 amino acids Enables combinations...
The genetic code___ Enables combinations of nucleotides to code for the 20 amino acids Enables combinations of mRNAs to code for the 20 amino acids Enables genes to translate polypeptides into ribosomes Enables genes to translate ribosomes into polypeptides
1. Summarize the main features or characteristics of the genetic code, including start & stop codons....
1. Summarize the main features or characteristics of the genetic code, including start & stop codons. 2. What is meant by base pair “wobble” and why might it be beneficial? 3. Describe the synthesis (and specificity) of aminoacyl-tRNA’s. 4. Name & describe the details in each of the three stages of protein synthesis, including the structure & functions of ribosomes and any factors involved. 5. Illustrate and/or describe the general structural, physical and/or chemical characteristics of amino acids. 6. Describe...
What are the amino acids that correspond to the first six complete codons in Exon 2?...
What are the amino acids that correspond to the first six
complete codons in Exon 2?
In terms of nucleotides and amino acids,
how do the Exon 2 sequences differ between the ky and
KB alleles?
What is Millie’s genotype for CBD103 (K locus)? Can you predict
a phenotype?
What is Thor’s genotype for CBD103 (K locus)? Can you predict a
phenotype?
CBD103 exon2 KB Thor CBD103_exon2_ky Millie ----------- 0 --TCCCTACCTGACCCTAAGGAGAAGTGTGTACTGGGGCTCAGGGGAAGAGTAAGA 54 CTGAACTCCCTACCTCACCCTAAGCAGAAGTGTGTACTGGGGCTCAGGGGAAGAGTAAGA 60 CBD103_exon2_KB Thor CBD103_exon2_ky Millie --------- 0...
60) Lipids are composed of: c) fatty acids and glycerol amino acids and glycerol nucleic acids...
60) Lipids are composed of: c) fatty acids and glycerol amino acids and glycerol nucleic acids and glycerol fatty acids and water fatty acids and sugar e) 61) The bond between two amino acids is a: a) hydrogen bond b) covalent bond c) peptide bond d) b and c e) none of the above 62) Hemoglobin has which tertiary structure: a) fibrous b) globular c) four subunits--two alpha chains, two beta chains d) alpha helix e) none of the above...
Question 5 -- / 1 There are different amino acids, and possible codons. 1 3; 20 2 3; 64 3 20; 3 4) 20; 64 5) 64; 3 6 64; 20 Question 6 -- / 1 Which of the following contains an open reading frame (consider the given strand only)? 1 AUGCCCGGGCGAGAC UAUGCGCAACCUGAG N 3 AAAUGAUGACCCAAA 4 UAUGCCGUCGUGAGG 5 UGAUUUCCCGGGCAA Which of the following is true? The initiator tRNA starts in the A site of the ribosome during translation initiation,...
Question 8 2.5 pts If a protein (polypeptide) is composed of 210 amino acids, how many mRNA codons would be required? Question 9 2.5 pts If a protein (polypeptide) is composed of 210 amino acids, how many mRNA ribonucleotides would be required?
The genetic code is considered degenerate because most amino acids are encoded by at least two different codons. Some researchers have hypothesized that during evolution the genetic code has been optimized for its intended use in different organisms. Reseachers can study this by examining the relationship between the frequency with which an amino acid appears in all the proteins in an organism and the total number of codons for an amino acid. An optimized organism would use amino acids in...
Question 36 The genetic code is a listing that gives the relationship between? O codons and amino acids O codons and anticodons codons and genes anticodons and genes Question 37 A human cell normally contains how many chromosomes?
Problems 1) Look at the structure of the natural amino acids (look them up). What do the 8 primordial amino acids have in common (generally)? What do you notice about the ones with 2 or fewer codons? 2) Calculate the actual information content per amino acid of protein translation by using the genetic code and the fact that in nature, the frequency of U and C is 22%, A is 30% and G is 26%. Finally, since 3 of 64...
U Question 9 1 pts The following Kekule structure is one of 20 essential amino acids found in the human body. Determine its chemical formula. Y OH NH2 Enter the formula without any spaces in the following format: CxH,OzNw
What are the amino acids that correspond to the first six
complete codons in Exon 2?
In terms of nucleotides and amino acids,
how do the Exon 2 sequences differ between the ky and
KB alleles?
What is Millie’s genotype for CBD103 (K locus)? Can you predict
a phenotype?
What is Thor’s genotype for CBD103 (K locus)? Can you predict a
phenotype?
CBD103 exon2 KB Thor CBD103_exon2_ky Millie ----------- 0 --TCCCTACCTGACCCTAAGGAGAAGTGTGTACTGGGGCTCAGGGGAAGAGTAAGA 54 CTGAACTCCCTACCTCACCCTAAGCAGAAGTGTGTACTGGGGCTCAGGGGAAGAGTAAGA 60 CBD103_exon2_KB Thor CBD103_exon2_ky Millie --------- 0...
60) Lipids are composed of: c) fatty acids and glycerol amino acids and glycerol nucleic acids and glycerol fatty acids and water fatty acids and sugar e) 61) The bond between two amino acids is a: a) hydrogen bond b) covalent bond c) peptide bond d) b and c e) none of the above 62) Hemoglobin has which tertiary structure: a) fibrous b) globular c) four subunits--two alpha chains, two beta chains d) alpha helix e) none of the above...
Most questions answered within 3 hours.
-
(CO 2) A field can be added to a report to
values for two or more...
asked 1 hour ago -
Identify 3 research scenarios that might provide a low,
medium, and high degree of variability in...
asked 1 hour ago -
how
does gravity affect the trajectory of projectile? what would be the
shape of the trajactory...
asked 2 hours ago -
Two small plastic spheres are given positive electrical charges.
When they are a distance of 15.4...
asked 2 hours ago -
An acidic solution containing gold ions is
electrolyzed, producing gaseous oxygen (from water) at the anode...
asked 2 hours ago -
Assume that the population of Mexico is 128
million and that the population increases 1.01
percentannually....
asked 3 hours ago -
Can someone please help me add appropriate descriptive
comments to each line of code in the...
asked 3 hours ago -
Romeo wishes to throw a bouquet of flowers to Juliet, who is on
a second-story balcony,...
asked 4 hours ago -
Why is QE a controversial monetary policy tool.
A. It may lead to excessive inflation.B. By...
asked 4 hours ago -
Principles of Programming midterm study guide help!
1.)
______ Which of the following would reference the...
asked 4 hours ago -
A finite potential well has depth U0 = 2.78 eV . What is the
penetration distance...
asked 5 hours ago -
1. The bus bars of a power station are in two sections A and B
separated...
asked 5 hours ago