Homework Answers
If a codon on mRNA is UGC, the anticodon on tRNA will be ACG and it will make Cysteine amino acid.
Ans.: ACG, cysteine.
Note: However, according to wobble hypothesis, UGC can have four different anticodons such as
ACG (Cysteine),
GCG (Alanine),
AUG (Methionine),
GUG (Valine).
So, along with ACG (Cysteine), AUG (Methionine) is also the possible answer here for this question.
If we don't consider wobble hypothesis, ACG (Cysteine) is the correct answer.
Add Answer to:
help
Question 10 If a codon on mRNA IS UGC what will be the anticodon on...
QUESTION 6 The DNA sense (coding) strand for a particular amino acid is 5'-CAT-3'. What RNA...
QUESTION 6 The DNA sense (coding) strand for a particular amino acid is 5'-CAT-3'. What RNA sequence would be transcribed for this codon, what tRNA anticodon would recognize it, and what amino acid would be added in response to this codon? O 5'-UUU-3' (RNA sense); 3'-AAA-5' (tRNA anticodon); phenylalanine O 5'-CAU-3' (RNA sense); 3'-GUA-5' (tRNA anticodon); histidine O 5'-CAU-3' (RNA sense); 3'-AUG-5’ (tRNA anticodon); tyrosine O 3'-AUG-5' (RNA sense); 3'-UAC-5' (TRNA anticodon); valine QUESTION 7 The “wobble” base is less...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
B) If this mRNA is translated beginning with the first AUG codon in its sequence, what is...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
Match the codon with the anticodon. Drag the appropriate labels to their respective targets. Help Reset...
Match the codon with the anticodon. Drag the appropriate labels to their respective targets. Help Reset Codon Anticodon GUC AAA UGC GCA UUU CUU AAG AGG AGG CCU CCU GGU ACC UCA UGA GAC
Question 9: The genetic code is read in groups of three nucleotides, called codons, in mRNA...
Question 9:
The genetic code is read in groups of three nucleotides, called
codons, in mRNA that specifies for a particular amino acid.
tRNA molecules act as the amino acid carriers that by correctly
pairing with the codon on mRNA can deliver the correct amino acid
to the ribosome during translation. At the tip of each tRNA
molecule is a group of three nucleotides called an anticodon and at
the other end is where the corresponding amino acid is attached...
Use the genetic code table to answer the following question: Second Base First Base Third Base...
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
Genetics! help please May S Tae suumissis hot be accepted. 1. (10 points) A series of...
Genetics! help please
May S Tae suumissis hot be accepted. 1. (10 points) A series of tRNAs have the anticodon sequences shown below Considering wobble, use Figure 13.12 to determine the possible codons with which each tRNA could pair Posible codons (Indicate the s end of each codon) Anticodon sequence 5-ACG-3 5'-xm UmGG-3 5'-IGA-3' Indicate which amino acid would be covalently bonded to tRNAs with the anticodon sequences given above. Use Table 13.1 to help you with your answer. Anticodon...
Question 24 Refer to the table below to answer the following question. А G U Serine...
Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...
3. What are the “translator” molecules that recognize a codon in the mRNA and deliver the correct...
3. What are the “translator” molecules that recognize a codon in the mRNA and deliver the correct amino acid? 6. If each amino acid was encoded by a single codon, what is the minimum number of amino-acyl tRNA synthetases required for translation? 7. Looking at the codon table, if there was a unique aminoacyl-tRNA synthetase required for each anticodon, what is the minimum required? 9. If an aminoacyl-tRNA synthetase recognized any nucleotide (purine or pyrimidine) in the 5’end of the anticodon,...
QUESTION 6 The DNA sense (coding) strand for a particular amino acid is 5'-CAT-3'. What RNA sequence would be transcribed for this codon, what tRNA anticodon would recognize it, and what amino acid would be added in response to this codon? O 5'-UUU-3' (RNA sense); 3'-AAA-5' (tRNA anticodon); phenylalanine O 5'-CAU-3' (RNA sense); 3'-GUA-5' (tRNA anticodon); histidine O 5'-CAU-3' (RNA sense); 3'-AUG-5’ (tRNA anticodon); tyrosine O 3'-AUG-5' (RNA sense); 3'-UAC-5' (TRNA anticodon); valine QUESTION 7 The “wobble” base is less...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
Match the codon with the anticodon. Drag the appropriate labels to their respective targets. Help Reset Codon Anticodon GUC AAA UGC GCA UUU CUU AAG AGG AGG CCU CCU GGU ACC UCA UGA GAC
Question 9:
The genetic code is read in groups of three nucleotides, called
codons, in mRNA that specifies for a particular amino acid.
tRNA molecules act as the amino acid carriers that by correctly
pairing with the codon on mRNA can deliver the correct amino acid
to the ribosome during translation. At the tip of each tRNA
molecule is a group of three nucleotides called an anticodon and at
the other end is where the corresponding amino acid is attached...
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
Genetics! help please
May S Tae suumissis hot be accepted. 1. (10 points) A series of tRNAs have the anticodon sequences shown below Considering wobble, use Figure 13.12 to determine the possible codons with which each tRNA could pair Posible codons (Indicate the s end of each codon) Anticodon sequence 5-ACG-3 5'-xm UmGG-3 5'-IGA-3' Indicate which amino acid would be covalently bonded to tRNAs with the anticodon sequences given above. Use Table 13.1 to help you with your answer. Anticodon...
Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...
Most questions answered within 3 hours.
-
Let X be a continuous random variable whose PDF is Let X be a
continuous random...
asked 19 minutes ago -
Martinez Company’s relevant range of production is 7,500 units
to 12,500 units. When it produces and...
asked 16 minutes ago -
A football with a mass of 1.2 kg is kicked from ground level to
a height...
asked 22 minutes ago -
Remember: Changes in supply determinants shift supply, and
changes in demand determinants shift demand. We say...
asked 21 minutes ago -
Why is the answer b), for this question? I came up with C) for
my incorrect...
asked 27 minutes ago -
Suppose that you know that in the population of full-time
employees in the United States, the...
asked 49 minutes ago -
This experiment was designed originally to sample various meat and carcass quality
aspects of Ontario pigs...
asked 49 minutes ago -
Dopamine Hydrochloride: draw the structure And Show the
functional groups in different colors and label the...
asked 41 minutes ago -
A rope supports a 10 kg dumbbell hanging from it. What is the
tension in the...
asked 41 minutes ago -
) Raw materials are studied for contamination. Suppose that
the number of particles of contamination per...
asked 1 hour ago -
After running a regression analysis we calculated an F test and
the significance level was 0.15....
asked 59 minutes ago -
----Can someone please help me solve this one using JAVA
----I thank you in advance
Create...
asked 1 hour ago