ZuoTi.Pro
Question

4. (1 pts) How does the ribosome know to bind to the first AUG and not to another AUG? 5. (1 pts) The ribosome is a ribozyme
science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

Ans-1 The ribosome know to bind to the 1st AUG and not to the another because of the initiating AUG is guided to its correct position by the Shine dalgarno sequence. This sequence has a type of initiating signal which is of about 4-9 purine residues, 8 to 13 bp . This is present towards the 5' side of the initiation codon. Now these purine bases pairs binds with complementary pyrimidine-rich sequence near the 3' end of 16rRNA of the 30S ribosomal subunit. So the interactions between first AUG and ribosome causes specify that it is first AUG and not other . Other factors that specify this binding is- interactions between ribosomal P site and fmet-tRNA fmet.

ans-5 yes a ribosome is a ribozyme. This means that ribosome is a RNA enzyme that catalyzes important chemical reactions just as ribozyme does. Ribosomes consists of ribozyme that have provides us with catalytic activity for certain chemical reactions.

Two pieces of evidence- • Ribosomes are made up of different subunit which in turn consists of ribosomal subunits with catalytic properties . Fro eg 70 S Ribosome is made up of 50S and 30S subunit while they are also made up of smaller rRNA units.

• These rRNA units catalyzes many reactions like binding of correct initiating codon, conversion of two aminos acids into a peptide bond etc.

So these are the evidences that ribosome is a ribozyme.

If you like my answer please upvote

0 0
Add a comment
Know the answer?
Add Answer to:
4. (1 pts) How does the ribosome know to bind to the first AUG and not...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • numbers in bacteria. In contrast, the gene for ribosomal 1. (1 pts) rRNA genes are usually...

    numbers in bacteria. In contrast, the gene for ribosomal 1. (1 pts) rRNA genes are usually present on large numbers in bacteria. In contrast, the ge proteins are few. Explain why. 2. (2 pts) Name 4 different molecules that physically interact with tRNA 3. (1 pts) Would a substitution within a codon for Trp always change the resulting protein sequence? Explain your answer. 4. (1 pts) How does the ribosome know to bind to the first AUG and not to...

  • 1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What...

    1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 2. (4 pts.) Describe the difference between cotranslational and post translational protein localization. Be specific-a well-labeled diagram could help. 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the-10 and the -35 sites and RNA polymerase plus sigma factor. 4. (4 pts.) Describe in detail the movement of...

  • 1. Describe the differences between prokaryotic and eukaryotic translation initiation. How does the ribosome find the...

    1. Describe the differences between prokaryotic and eukaryotic translation initiation. How does the ribosome find the correct start codon and what proteins are involved in the process? please include the shine-dalgarno sequence in the answer. 2. Consider the following partial sequence of messenger RNA. The sequence below contains the code for a short, complete protein. 5 ́-UCCCCAGUCAUGGAGUCGUUAAUUAAAUGACCGGUGCGGAUCGUA - 3 ́ Using the codon chart (from your textbook or in the lecture slides), give the amino acid sequence of the protein...

  • Quiz Instructions Question 5 1 pts In eukaryotic cells, where does the basal transcription apparatus bind?...

    Quiz Instructions Question 5 1 pts In eukaryotic cells, where does the basal transcription apparatus bind? O core promoter O enhancer O regulatory promoter O terminator Next Previous Quiz saved at 12:40pm Submit

  • i need different answer 4. (2 pts) How does an accountant determine if a transaction is...

    i need different answer 4. (2 pts) How does an accountant determine if a transaction is material and should be recorded? TF the event effect Financial Pesformre 5. (3 pts) Explain the concept of Recognition. What are the two tests to determine if transaction can be recognized? To Formaliy reerd time the n cLanntine recerds duro t Perisd te Vevenue campanc e arn must 1 2 e realized Yevenue ust be haalisable 6. (2 pts) Give an specific example of...

  • [4] Liverworts are the most ancient group of extant plants; successfully colonizing the land during the...

    [4] Liverworts are the most ancient group of extant plants; successfully colonizing the land during the Ordovician at least 470 mya. A. Present evidence that supports their ancient status and their origins during the Ordovician (you need at least 4 pieces of evidence). Be sure to explain why or how each piece of evidence supports the ancient status of the liverworts. (8 pts.) B. From what you now know about the origins and life strategies of gametophyte dominant plants, i.e.,...

  • At what temperature does ice melt? How do you know?

    Dater Name Part 5: Specific Heat of Water For such a small molecule, water has a very high specific heat. This means it takes a lot of energy to raise the temperature of water. Another important property is the range of temperature for which water remains a liquid. When water evaporates, like from sweat, it also removes a lot of heat from our body. Using the data below, create a graph to demonstrate the heating curve of water. The water starts...

  • 1. How is the start codon identified in prokaryotic cells? a. It is the only AUG...

    1. How is the start codon identified in prokaryotic cells? a. It is the only AUG on the mRNA strand. b. It is the AUG after the Shine-Dalgarno sequence. c. It is the AUG right next to the promoter on the mRNA. d. It is the AUG after the Kozak sequence. e. It is the AUG nearest the 5' end of the mRNA. 2. All of the following are true for eukaryotic transcription EXCEPT: a. Transcription can be terminated when...

  • = = = ab X, X ADA = = av AJ Styles Part Four: Translation: Synthesis...

    = = = ab X, X ADA = = av AJ Styles Part Four: Translation: Synthesis of the amino acid sequence. 1. Where inside the cell does translation occur? 2. The large and small ribosomal subunits are already attached to one another. a. What is the function of a ribosome? 3. Notice that the mRNA strand fits into the ribosome. The mRNA AUG start codon occupies the first slot on the ribosome. The next codon occupies the second slot. 4....

  • 1.How does Descartes know he exists? a)He can't know this. b) God told him.   c) He...

    1.How does Descartes know he exists? a)He can't know this. b) God told him.   c) He thinks. 2. What does Descartes prove himself to be? a) A body. b) A thinking thing. c) A soul. 3. With what faculty does Descartes believe he truly grasps what the wax is? a)The academic faculty.    b) The faculty of judgment. c) The faculty of intuition or understanding. These question are from Descartes meditation article These questions are from Descartes meditation article.

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT