15. The different tRNAs are produced by: A. Different aminoacyl-tRNA synthetases that produce tRNAs from ribonucleotides...
15. The different tRNAs are produced by:
A. Different aminoacyl-tRNA synthetases that produce tRNAs from ribonucleotides in the cytoplasm
B. RNA editing of transcripts of a single tRNA gene
C. Alternatively spliced of a single tRNA gene
D. Transcription of different tRNA genes in the genome.
Homework Answers
Answer 15:
tRNA plays an important role during translation, by bringing the correct amino acid to growing amino acid chain. There are 20 amino acids and about 31 tRNA are at work. Aminoacyl-tRNA synthetases aid in linking amino acid to the correct tRNA (this step is called tRNA charging).
The different tRNAs are produced by transcription of different genes . The correct choice should be:
(D) Transcription of different tRNA genes in the genome.
Add Answer to:
15. The different tRNAs are produced by:
A. Different aminoacyl-tRNA synthetases that produce tRNAs from
ribonucleotides...
can you guys please give me the correct answers and explain why? 25. The non-template strand...
can you guys please give me the correct answers and explain
why?
25. The non-template strand of an E. coli gene is the following sequences matches the resulting RNA. Strand of an E. coli gene is listed below. The +1 is indicated. Which of +1 TATAATAGACAGAATTGATGCGTA A. UAUAAUAGACAGA B. TCTGTCTATTATA C. UCUGUCUAUUAUA D. AAUUGAUGCGUA EUACGCAUCAAUU 26. Which of the following statements concerning aminoacyl-tRNA synthetases is correct A. Because the genetic code is degenerate, cells must contain a specific aminoacyl- tRNA...
The rough endoplasmic reticulum (rough ER) is different from the smooth ER because A. the rough...
The rough endoplasmic reticulum (rough ER) is different from the smooth ER because A. the rough ER has lipids bound on its surface. B. aminoacyl-tRNA synthetases join amino acids to tRNAs on it. C. the rough ER has many ribosomes bound to it. D. smooth ER is coated by messenger RNAs. E. RNA polymerases are found all over the rough ER.
7. In bacteria the elongation stage of protein synthesis does not involve: A) aminoacyl-tRNAS B) EF-Tu...
7. In bacteria the elongation stage of protein synthesis does not involve: A) aminoacyl-tRNAS B) EF-Tu C) GTP D) IF-2 E) peptidyl transferase Which of the following best describes the cholesterol molecule? A) Amphipathic B) Nonpolar, charged C) Nonpolar, uncharged D) Polar, charged E) Polar, uncharged The enzyme that attaches an amino acid to a tRNA (aminoacyl-tRNA synthetase): A) always recognizes only one specific tRNA. B) attaches a specific amino acid to any available tRNA species. C) attaches the amino...
Which of the following is NOT a feature of RNA processing in eukaryotes? a. Caps and...
Which of the following is NOT a feature of RNA processing in eukaryotes? a. Caps and tails are added to RNA transcripts before they leave the nucleus b. Multiple genes are represented in one mRNA from an operon c. Introns are removed and exons are spliced back together to make mature mRNA d . "Alternative splicing" means that one gene in the genome can encode multiple products e. The sequence that codes for one eukaryotic gene is not a continuous...
answer all the questions 18) A mutation occurs such that a spliceosome cannot remove one of...
answer all the questions
18) A mutation occurs such that a spliceosome cannot remove one of the introns in a gene. What effect will this have on the gene? Translation will continue, but a nonfunctional protein will be made b) Translation will continue and will skip the intron sequence c) It will have no effect; the gene will be transcribed and translated into protein d) Transcription will terminate easily and the protein will not be made 19. During the process...
Which of these is involved in the transcription of tRNA genes? A. RNA Pol 1 B....
Which of these is involved in the transcription of tRNA genes? A. RNA Pol 1 B. RNA Pol 2 C.RNA Pol 3 D.RNA Pol 4 E. Not sure A promoter is.... A. Proteins that defines the beginning of a gene B. DNA elements that help define the beginning of a gene C. It is the DNA sequence at the start of a gene D. Not sure Promoters TATA Start site What is the TATA box? A. It's a DNA sequence...
Question 4) Trans-splicing is a special form of RNA splicing that occurs in 70-80% of all...
Question 4) Trans-splicing is a special form of RNA splicing that occurs in 70-80% of all genes in the soil nematode C. elegans. In trans-splicing, the exons from two different primary RNA transcripts produced in different portions of the genome are joined end-to-end and ligated. Do you consider these trans-spliced sequences of real genes or are they instead the product of a fusion of two genes? Question 5) Recently researchers discovered a new class of mRNA regulators named miRNAs. miRNAs...
Question 4) Trans-splicing is a special form of RNA splicing that occurs in 70-80% of all...
Question 4) Trans-splicing is a special form of RNA splicing that occurs in 70-80% of all genes in the soil nematode C. elegans. In trans-splicing, the exons from two different primary RNA transcripts produced in different portions of the genome are joined end-to-end and ligated. Do you consider these trans-spliced sequences of real genes or are they instead the product of a fusion of two genes? Question 5) Recently researchers discovered a new class of mRNA regulators named miRNAs. miRNAs...
PLEASE ANSWER ALL THE QUESTIONS: 1.What is true of tRNA (transfer RNA)? A they contain an...
PLEASE ANSWER ALL THE QUESTIONS: 1.What is true of tRNA (transfer RNA)? A they contain an anti-codon B they carry an amino acid C they can interpret the genetic code D all of these are true 2. How can transcription factors bound to distant enhancers influence gene expression? A the transcription factors can slide along the DNA until they get to the gene's promoter B DNA can loop, bringing these proteins into contact with the gene's promoter C both of...
Please Help following questions 20. Genome wide association studies have been used to: A) Find highly...
Please Help following questions
20. Genome wide association studies have been used to: A) Find highly penetrant genes responsible for single gene disorders B) Look for associations between genotype and phenotype in families C) Demonstrate a link between viruses and cancer D) Find common low penetrance variants that contribute to multifactorial genetic diseases E) Establish which genes are most highly expressed in cancer 16. Which of the following statements about human genes is correct? A) All genes produce proteins B)...
can you guys please give me the correct answers and explain
why?
25. The non-template strand of an E. coli gene is the following sequences matches the resulting RNA. Strand of an E. coli gene is listed below. The +1 is indicated. Which of +1 TATAATAGACAGAATTGATGCGTA A. UAUAAUAGACAGA B. TCTGTCTATTATA C. UCUGUCUAUUAUA D. AAUUGAUGCGUA EUACGCAUCAAUU 26. Which of the following statements concerning aminoacyl-tRNA synthetases is correct A. Because the genetic code is degenerate, cells must contain a specific aminoacyl- tRNA...
7. In bacteria the elongation stage of protein synthesis does not involve: A) aminoacyl-tRNAS B) EF-Tu C) GTP D) IF-2 E) peptidyl transferase Which of the following best describes the cholesterol molecule? A) Amphipathic B) Nonpolar, charged C) Nonpolar, uncharged D) Polar, charged E) Polar, uncharged The enzyme that attaches an amino acid to a tRNA (aminoacyl-tRNA synthetase): A) always recognizes only one specific tRNA. B) attaches a specific amino acid to any available tRNA species. C) attaches the amino...
answer all the questions
18) A mutation occurs such that a spliceosome cannot remove one of the introns in a gene. What effect will this have on the gene? Translation will continue, but a nonfunctional protein will be made b) Translation will continue and will skip the intron sequence c) It will have no effect; the gene will be transcribed and translated into protein d) Transcription will terminate easily and the protein will not be made 19. During the process...
Which of these is involved in the transcription of tRNA genes? A. RNA Pol 1 B. RNA Pol 2 C.RNA Pol 3 D.RNA Pol 4 E. Not sure A promoter is.... A. Proteins that defines the beginning of a gene B. DNA elements that help define the beginning of a gene C. It is the DNA sequence at the start of a gene D. Not sure Promoters TATA Start site What is the TATA box? A. It's a DNA sequence...
Question 4) Trans-splicing is a special form of RNA splicing that occurs in 70-80% of all genes in the soil nematode C. elegans. In trans-splicing, the exons from two different primary RNA transcripts produced in different portions of the genome are joined end-to-end and ligated. Do you consider these trans-spliced sequences of real genes or are they instead the product of a fusion of two genes? Question 5) Recently researchers discovered a new class of mRNA regulators named miRNAs. miRNAs...
Question 4) Trans-splicing is a special form of RNA splicing that occurs in 70-80% of all genes in the soil nematode C. elegans. In trans-splicing, the exons from two different primary RNA transcripts produced in different portions of the genome are joined end-to-end and ligated. Do you consider these trans-spliced sequences of real genes or are they instead the product of a fusion of two genes? Question 5) Recently researchers discovered a new class of mRNA regulators named miRNAs. miRNAs...
Please Help following questions
20. Genome wide association studies have been used to: A) Find highly penetrant genes responsible for single gene disorders B) Look for associations between genotype and phenotype in families C) Demonstrate a link between viruses and cancer D) Find common low penetrance variants that contribute to multifactorial genetic diseases E) Establish which genes are most highly expressed in cancer 16. Which of the following statements about human genes is correct? A) All genes produce proteins B)...
Most questions answered within 3 hours.
-
On January 1, 2019, ABC Company issued $60,000,000 of 20-year,
10.5% bonds when the market rate...
asked 11 minutes ago -
39.4% of US homes continue to use a landline in addition to cell
phone service. 3...
asked 50 minutes ago -
Starting with benzene, synthesize 1-phenyl-1-butyne.
Show intermediates and reagents.
asked 1 hour ago -
Create a 32-run crossed array design with six control factors
and two noise factors such that...
asked 2 hours ago -
A 500g sample of sand from source A has the following amounts
retained on each sieve....
asked 2 hours ago -
In
your own words, please explain the essay by John Keynes wrote "The
End of Laissez...
asked 2 hours ago -
How are the matrix and pixels related? Why are smaller
pixels better for diagnostic quality?
asked 2 hours ago -
2. An AC generator has 80 rectangular loops on
its armature. Each loop is 11 cm...
asked 2 hours ago -
Please help me with this question. Consider Aldi’s current and
potential geographic markets (see Exhibit 4...
asked 2 hours ago -
What are the main components of the fermentation process and
give an explanation of each? Include...
asked 3 hours ago -
Explain which types of cells in the body (belonging to which
organs, etc.) are sensitive to...
asked 3 hours ago -
A single cable supports an 703-kg elevator car. What is the
tension in the cable when...
asked 3 hours ago