Question
please help with genetics !!
5. Translate the RNA sequence below using three possible reading frames. 5 AGUCUAGGCACUGA 3 If this segment of RNA is found
0 0
Add a comment Improve this question Transcribed image text
Answer #1

5) for a single-stranded RNA there are three possible reading frames one starts at the first nucleotide at the 5` end, the second reading frame starts at the second nucleotide at the 5` end, the third reading frame starts at the third nucleotide from the 5` end.

the amino acid sequence using the first reading frame

Ser-Leu-Gly-Thr

the amino acid sequence using the second reading frame

Val-Ala-Leu

the amino acid sequence using the third reading frame

Ser-Arg-His-

so the given sequence is part of an mRNA for a large protein because the given mRNA does not have an open reading frame, so the first reading frame is used, in the original mRNA it does not have any stop codon in between, the stop codon is represented by `-` the other two reading frames have stop codons in between.

Add a comment
Know the answer?
Add Answer to:
please help with genetics !! 5. Translate the RNA sequence below using three possible reading frames....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 7. Open reading frames A protein coding gene includes the following sequence on one of its...

    7. Open reading frames A protein coding gene includes the following sequence on one of its two DNA strands. Note that this segment (within an exon) does NOT include either the start codon or the stop codon for this gene. However, because five of the six potential reading frames (3 on each DNA strand) in this region include stops, only the true reading frame remains "open" through this segment. Therefore, it is possible to unambiguously decode (translate) this segment of...

  • genetics i need help woth good details How many possible open reading frames (frames without stop...

    genetics i need help woth good details How many possible open reading frames (frames without stop codons) exist that extend through the following sequence? Note: since this is a partial sequence, do not consider start codons when looking for open reading frames. (STOP CODONS = UAA, UAG, UGA) 5 -----CTTACAGTTTATTGATACGGAGAAGG----3' 3'-----GAATGTCAAATAACTATGCCTCTTCC-----5' HTML Editora

  • 4. Given the following information: One strand of a section of DNA isolated from E. coli...

    4. Given the following information: One strand of a section of DNA isolated from E. coli reads                                     5’-GTAGCCTACCCATAGG-3’                                     3’ CATCGGATGGGTACC’5 Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be (please include orientation)? How many different polypeptides chains could potentially be made from this sequence of RNA? Would the same polypeptide chains be made if the other strand of the DNA...

  • 1.)Translate a piece of RNA in ALL three reading frames. (5pts) 3.)Deeply understand LActose and Tryptophan...

    1.)Translate a piece of RNA in ALL three reading frames. (5pts) 3.)Deeply understand LActose and Tryptophan operons, Given media composition, will specific genes be turned "on" or "off". (18pts) 4.)Two different forms of the same protein. From the evidence provided, Is this being manufactured by ONE or TWO different forms of protein? (4pts)

  • Augu Q46. Below is a DNA sequence from a yeast GPCR gene. Using RNA sequencing methods...

    Augu Q46. Below is a DNA sequence from a yeast GPCR gene. Using RNA sequencing methods you have obtained the following partial 5' sequence for the MRNA transcribed from this gene: 5'-GGUCCAU... 5'GTATAAGAAGCACTCTACCTCAATGGGTCCATGGGAGAAGGTAGGCATGTGTATTTGACAAAGGGA i. What are the most likely six N-terminal amino acids for the above gene? (2 pts) Examine the other reading frames. Explain why you can exclude those other possible reading frames from consideration (one or two reasons depending upon the frame). (2 pts) Circle the portion of...

  • Microbiology questions: (Please answer all three if possible) Shown below is a partial sequence of an...

    Microbiology questions: (Please answer all three if possible) Shown below is a partial sequence of an RNA molecule. 5' GUACUAAGGAGGUG1 UGU2 GAUGAACCAAGUCUAGGG... 1. Could this be mRNA? Why or why not? 2. What determines whether or not a piece of RNA will be translated? 3. What is meant by "setting the frame"? Would the frame change if you deleted the base marked G1 on the sequence above? Why or why not?

  • 3. Translation. According to the rules of the genetic code, there are six different reading frames...

    3. Translation. According to the rules of the genetic code, there are six different reading frames in a double- stranded DNA molecule. One DNA strand serves as a template for transcription, which is complementary and antiparallel to the RNA product. The other DNA strand is the coding strand, which is identical in sequence to the RNA except for the substitution of uracil for thymine bases. A) There is a single open-reading frame (ORF) in the DNA molecule shown below. [Recall...

  • Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...

    Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...

  • Overview The purpose of this activity is to help the students to understand how replication, tran...

    TranslationOverview:The purpose of this activity is to help the students to understand how replication, transcription, and translation are connected. Students will use a sequence from a bacterial gene that confers resistance to antibiotics (carbapenems). They will be asked to apply the knowledge obtained in the class lecture to (1) find the promoter in the sequence, (2) determine the amino acid sequence of a fragment of the polypeptide, (3) "reverse translate" a fragment of the polypeptide, and (4) identify mutations in...

  • pls fo all 20) A) an enzyme that synthesizes RNA as part of the transcription process...

    pls fo all 20) A) an enzyme that synthesizes RNA as part of the transcription process B) an enzyme that uses RNA as a substrate C) an enzyme that catalyzes the association between the large and small ribosomal subunits D) an enzyme that synthesizes RNA primers during DNA replication E) an RNA with enzymatic activity 20) What is a ribozyme? 21) 21) Alternative RN A splicing A) increases the rate of transcription. B) can allow the production of similar proteins...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT