Question

genetics i need help woth good details

How many possible open reading frames (frames without stop codons) exist that extend through the following sequence? Note: since this is a partial sequence, do not consider start codons when looking for open reading frames. (STOP CODONS = UAA, UAG, UGA) 5 -----CTTACAGTTTATTGATACGGAGAAGG----3' 3'-----GAATGTCAAATAACTATGCCTCTTCC-----5' HTML Editora

Answer 1

In the following sequence I am considering the lower 3" - >5' strand for finding ORF.

ORFs are identified by taking triplets until one encounters a termination codon. However in this question it is given to identify the ORFs without stop codons. Here the stop codons are TAA, TAG and TGA since it is a DNA fragment.

Frame 1 - 3' GAA TGT CAA ATA ACT ATG CCT CTT CC 5' (No stop codon)

Frame 2 - 3' G AAT GTC AAA TAA CTA TGC CTC TTC C 5' (One stop codon)

Frame 3 - 3' GA ATG TCA AAT AAC TAT GCC TCT TCC 5' (No stop codon)

Now we have to find the reverse complement of this 3'-> 5' strand. This is done by first considering the opposite 5'->3' strand which is the complement and then reversing it placing G in place of A and C in place of T and vice-versa.

Reverse complement - 3' TCCGTGACCCGCCAGCGTAAGAGGAA 5'

Frame (-1) - 3' TCC GTG ACC CGC CAG CGT AAG AGG AA 5' (No stop codon)

Frame (-2) - 3' T CCG TGA CCC GCC AGC GTA AGA GGA A 5' (One stop codon)

Frame (-3) - 3' TC CGT GAC CCG CCA GCG TAA GAG GAA 5' (One stop codon)

Thus a total of 3 Open Reading Frames are identified.