Hello,
32.According to the given data one thing is very clear that the DNA is rich in G+C content,which in turn suggests that the Tm (melting temprature) of this DNA will be high.The second thing is that this data is of ssDNA because the ratio of purine and pyrimidine is not 1:1(Chargaff's rule).In dsDNA purine and pyrimidine are in the ratio of 1:1.
Hope this helps,please give your feedback.
32. Unknown DNA was analyzed and the result showed the nucleotide composition as follows: A T...
Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining DNA methylation and histone modifications. To examine methylation of a DNA sequence, you treat It with sodium bisulfite. If your original DNA sequence Is: ACAGTCCGTCGGAGCCTGCCAGTCGATCGCACCT and yum sequence after trearment reads ACAGTTCGTCGGAGCTTCTTAGTOSATCGCACTT. Which positions on the original DNA sequence are methylated? (Indicate methylations with an * after the affected nucleotide) b.) When this DNA sequence is replicated, which of these methylations will be transferred...
EXAMPLE: ANSWER 12 :- From the above mentioned data, the significance of ATP molecule in the event progression is seen although taking into consideration that the process is carried out in an in-vitro manner, the possibility of transcription occuring decreases taking into consideration the errors associated with the changes in certain conditions associated with the experimental setup and hence it becomes difficult to identify if there is actual phosphorylation occuring of the nucleosomal histone proteins. This in other terms cannot...
11 Department of Biological Sciences BIOCHEMISTRY Test 2.2018 H. Nucleic Acid, Sequencing of DNA: Amino Acids Hydrolysis of salt Laboratory buffers, Polyprotie acids QUESTIONS 1. The DNA strand complementary to the strand 3-GTAGCGTAT-Y' would have the sequence a SLTACOCATAT-3 b.3.CATOXICATA-S c. 3-ATGCGTATA-S" ATATGCGTAS 2. When cytosine is treated with bisulfite, the amino group is replaced with a carbonyl group. Identify the resulting base a. adenine b. guanine c uracil d. thyminee. typoxanthine 3. How many amino acids would be in...
explaim the mechanisms amd toxological effects if type 1 diabetes in this article Exposure to arsenic in drinking water is associated with increased prevalence of diabetes. We previously reported an association of diabetes and urinary concentration of dimethylarsinite (DMAS"), a toxic product of arsenic methylation by arsenic (+ 3 oxidation state) methyltransferase (AS3MT). Here we examine associations between AS3MT polymorphism, arsenic metabolism and diabetes. Fasting blood glucose, oral glucose tolerance and self-reported diagnoses were used to identify diabetic individuals. Inorganic...
1. Which of the following are the sites within the human body where carbon dioxide and oxygen are exchanged? A. Alveoli B. Arteries C. Synapses D. Venules 2. Which of the following describes the most important reason for repeating an experimental investigation? A. To verify the validity of the original findings B. To expand upon the original investigation C. To manipulate the independent variable D. To attempt to disprove the hypothesis 3. Lithium has an atomic number of 3 and...