how to solve this problem about PCR ( no band or faint band )?? 1- PCR...
Homework Answers
Q. how to solve this problem about PCR ( no band or faint band )??
3-Extension time was too short.
Add Answer to:
how
to solve this problem about PCR ( no band or faint band )??
1- PCR...
You are provided with two primers below and you wish to amplify the CYC1 terminatoron pMD1:...
You are provided with two primers below and you wish to amplify the CYC1 terminatoron pMD1: Primer 1: CTATGAAACAAGAATCGACC Primer 2: GTGCCGTAAAGCACTAAATC a. What secondary structure is formed by each primer at 54°C? b. What secondary structure is formed by both primers together at 54°C? c. If we were to use the following PCR protocol with primer 1 and primer 2, what would we expect to see on the electrophoresis gel? Step Time Temperature Initiation 2’ 95°C Denaturation 1’ 95°C...
Problem.1: What does a PCR optimization means? Problem.2: You are working on a gradient PCR to...
Problem.1: What does a PCR optimization means? Problem.2: You are working on a gradient PCR to determine the optimum annealing temperature for your primer, and you get the following result. Problem.5: Your target is to amplify a promoter region of TRF2 gene. You design the following primer pair: Forward: 5'- CAGCGCTGCCTGAAACTC-3: Tm: 58.6°C, length: 18 bp, GC%: 61.11% Reverse: 5'- GTCCTGCCCCTTCACCTT-3' Tm: 59°C, length: 18 bp, GC%: 61.11% Product size: 200 bp -You get the following result: Marker CC CCC...
This PCR step is called annealing. The annealing step follows the denaturation step: it is usually...
This PCR step is called annealing. The annealing step follows the denaturation step: it is usually the lowest temperature in the PCR. The temperature of this step varies with each PCR reaction because each primer has its own sequence and may not be an identical match to the DNA template strand. GC or CG have three hydrogen bonds and AT or TA have two hydrogen bonds. Higher annealing temperatures are more stringent and require a better match between primer and...
Now. you should be able to answer the following questions: • How the amplification will be...
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
Please, I need help with this question. Show work to solve the whole question 1. You...
Please, I need help with this question. Show work to solve the whole question 1. You are interested in cloning a gene from the B. sanfranciscus genome, so you design PCR primers that should amplify a 1 kilobase pair (kbp) PCR product that contains the gene of interest. After amplification, you will see if the PCR was successful by loading the entire reaction onto an agarose gel and performing electrophoresis to see if a product of the expected size was generated. To visualize...
Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain...
Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain reaction? a. To repair damaged DNA b. To make copies of entire chromosomes c. To make copies of specific regions of DNA d. To prepare cells for cell division 2. The polymerase chain reaction is most comparable to what cellular process? a. Mitosis b. Replication c. Transcription d. Translation 3. When enzymes are elongating (building) a newly synthesized DNA strand in PCR, new nucleotides...
1. The serum amyloid A (SAA) superfamily comprises a number of genes and proteins characterized f...
1. The serum amyloid A (SAA) superfamily comprises a number of genes and proteins characterized from a range of mammalian species. These proteins are dramatically induced during the acute-phase injury response, suggesting an important short-term beneficial role in the response to tissue injury and inflammation. However, important disease associations have also been proposed for certain SAAs during chronic inflammation. Serum amyloid A contributes to a variety of conditions wherein normally soluble proteins become insoluble and are deposited in the extracellular...
Hi there, can you guys teach me how to solve the second problem, please? This problem...
Hi there, can you guys teach me how to solve the second problem, please? This problem uses the data file called "12thWomanStoresData." Consider the variable Age. 1) What is the standard deviation of the age variable? 12.3890 years. (Round to 4 decimal places if necessary) 2) Now, supposed this variable was distributed normally. Between what two values would you expect to find 95% of the data observations? Answer: Between ... (on the low end) and ....... (on the high end)....
1.The minimum wavelength and the minimum wave length for visible light is about 0.4 um and...
1.The minimum wavelength and the minimum wave length for visible light is about 0.4 um and 0.7 um, respectively . Assume that the velocity of light is a constant of 3.0x10^8 m/s and Planck's constant is 4.13x10^-15 eV-s. What kind of material will appear colored? (a)The material with band gap of 1.0eV (b)The material with band gap of 2.0eV (c)The material with band gap of 3.2eV (d)The material with band gap of 3.5eV 2.Which kind of material is most likely...
1. What is happening in a healthy individual about an hour into a glucose tolerance test? (Note: At this early time-poin...
1. What is happening in a healthy individual about an hour into a glucose tolerance test? (Note: At this early time-point, blood glucose levels are still high. Also, remember that a person who is taking a glucose tolerance test was fasting for 12 hours prior to the test!) (Select ALL that apply!) Hint: Review pages 319-325, 462-467 and 489-491 of Tymoczko 3E before attempting this question. A. Glucose is being exported by the liver B. Glucose is being taken up...
Problem.1: What does a PCR optimization means? Problem.2: You are working on a gradient PCR to determine the optimum annealing temperature for your primer, and you get the following result. Problem.5: Your target is to amplify a promoter region of TRF2 gene. You design the following primer pair: Forward: 5'- CAGCGCTGCCTGAAACTC-3: Tm: 58.6°C, length: 18 bp, GC%: 61.11% Reverse: 5'- GTCCTGCCCCTTCACCTT-3' Tm: 59°C, length: 18 bp, GC%: 61.11% Product size: 200 bp -You get the following result: Marker CC CCC...
This PCR step is called annealing. The annealing step follows the denaturation step: it is usually the lowest temperature in the PCR. The temperature of this step varies with each PCR reaction because each primer has its own sequence and may not be an identical match to the DNA template strand. GC or CG have three hydrogen bonds and AT or TA have two hydrogen bonds. Higher annealing temperatures are more stringent and require a better match between primer and...
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain reaction? a. To repair damaged DNA b. To make copies of entire chromosomes c. To make copies of specific regions of DNA d. To prepare cells for cell division 2. The polymerase chain reaction is most comparable to what cellular process? a. Mitosis b. Replication c. Transcription d. Translation 3. When enzymes are elongating (building) a newly synthesized DNA strand in PCR, new nucleotides...
1. The serum amyloid A (SAA) superfamily comprises a number of genes and proteins characterized from a range of mammalian species. These proteins are dramatically induced during the acute-phase injury response, suggesting an important short-term beneficial role in the response to tissue injury and inflammation. However, important disease associations have also been proposed for certain SAAs during chronic inflammation. Serum amyloid A contributes to a variety of conditions wherein normally soluble proteins become insoluble and are deposited in the extracellular...
Most questions answered within 3 hours.
-
The average length of time between arrivals at a turnpike
toll-booth is 26 seconds. What is...
asked 37 minutes ago -
(a) A piston at 6.1 atm contains a gas that occupies a volume of
3.5 L....
asked 1 hour ago -
Please answer true or false. Words
cannot be changed or added in to make it true...
asked 1 hour ago -
An empty test tube weighs 15.923 grams. Then,
MgCl2•6H2O is added into the test tube. After...
asked 1 hour ago -
Assume memory access is 10 units of time and disk access is
10000 units of time....
asked 2 hours ago -
1. Are all good samples random?
2. Magazines often report surveys giving statistics such as “63%...
asked 2 hours ago -
Under all the various types of market structures, firms
must eventually earn some economic profits for...
asked 2 hours ago -
Consider the following fitness regime for a single locus trait
with two co-dominant alleles: w11 =...
asked 2 hours ago -
A large cable company reports the following.
80% of its customers subscribe to its cable TV...
asked 2 hours ago -
Please answer the question in brief.
Discuss the role of ERP in organizations. Are ERP tools...
asked 2 hours ago -
Discuss the pros and cons of collaborative software such
as SameTime. Does it increase productivity? What...
asked 2 hours ago -
Buying your in-laws a gift because it’s expected is
due to the ____________ motive of gift-giving....
asked 2 hours ago