Homework Answers
Answer: During transduction if a bacterial DNA fragment is assembled in the viral protein coat, it is called a phage particle.
Add Answer to:
QUESTION 6 During transduction if a bacterial DNA fragment is assembled in the viral protein coat,...
Please classify each statement as describing transformation, conjugation, or transduction in bacteria. Bacteria can acquire plasmids...
Please classify each statement as describing transformation, conjugation, or transduction in bacteria. Bacteria can acquire plasmids from outside the cell. A bacterium that contains an F plasmid connects to a recipient bacterium that lacks an F plasmid with an appendage called a pilus, through which the plasmid is transferred. Some bacterial DNA fragments may be included when new phage particles are assembled. A cell can be treated to make it competent to take up DNA from its environment. When a...
t Question 14 0/2 pts Which of these statements is about bacterial and viral genomes is...
t Question 14 0/2 pts Which of these statements is about bacterial and viral genomes is true? Bacterial genomes are always DNA, while some viral genomes are made from RNA. Bacterial genomes contain information used to make proteins, while viral genomes do not. Bacterial genomes do not contain information used to make proteins, while viral genomes do. Bacterial genomes are always DNA, while some viral genomes are made from protein.
QUESTION 42 Protein A is a viral protein of 100 amino acids. Protein B is a...
QUESTION 42 Protein A is a viral protein of 100 amino acids. Protein B is a viral protein of 500 amino acids. Which of the following is true concerning these two proteins? Protein B has more epitopes than protein A Protein A has less chance to be recognized by the host antibodies Protein B can activate more B cell clones than protein A during clonal selection All of the above QUESTION 41 Which one of these statements is true? Neurons...
1) Which of the following enzymes is capable of initiating DNA synthesis on a template: DNA...
1) Which of the following enzymes is capable of initiating DNA synthesis on a template: DNA polymerase I DNA polymerase II DNA polymerase III all of these are correct None of these are correct 2) In garden peas, yellow seed color is dominant over green seed color. A total of 4,092 offspring resulted in a cross between a heterozygous yellow and a homozygous green. Howmany of these seeds are homozygous green?" "4, 092" "3,069" "2,046" "1,023" None of these are...
UPCRISULAPIULULUIJM 4 Question 6 What are some differences between both, Sherlock and RT-PCR, AND the serological...
UPCRISULAPIULULUIJM 4 Question 6 What are some differences between both, Sherlock and RT-PCR, AND the serological test? Serological tests allow to detect individuals currently with the disease and that had the disease in the past. Serological tests require blood samples while the others can use nasal secretions. Serological tests detect human antibodies against COVID19 while the other tests detect viral genes. Serological tests detect viral genome while the other tests focus on viral RNA Question 7 6 p Regarding the...
QUESTIONS During replication the protein that keeps the two stands of DNA from popping back together...
QUESTIONS During replication the protein that keeps the two stands of DNA from popping back together is called Gene Semiconservative SSB Single Stranded Binding Protein ODNA polymerase QUESTION 2 Tachnow molecule of DNA is a double he which is made up of O two new stands of DNA one new strand and one old strand of DNA two old stands of DNA o the new strands of DNA QUESTIONS QUESTION 19 The process of synthesizing RNA from a specific sequence...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
Chapters 7, 8, 9 - Bacterial Growth & Metabolism (some chapter sections will be covered in...
Chapters 7, 8, 9 - Bacterial Growth & Metabolism (some chapter sections will be covered in lab) Prerequisite: Basic catabolic pathways (respiration and fermentation) and anabolic reactions (photosynthesis) BACTERIAL GROWTH AND CONTROL- Some of these topics will be covered in greater detail during lab Environmental Growth Factors 1. Discuss the specific role of quorum sensing in biofilm formation Control of Microbial Growth 2. Describe the methods used to control microbial growth 3. List the types of antibiotics that inhibit (a)...
QUESTION 13 Genetic change in bacteria can be brought about by Transduction. Mutation. Transformation. Conjugation. All...
QUESTION 13 Genetic change in bacteria can be brought about by Transduction. Mutation. Transformation. Conjugation. All of the above. ooo QUESTION 14 All of the following pertain to glycolysis except occurs without oxygen. ends with formation of pyruvic acid. occurs during fermentation. degrades glucose to CO2 and H20. involves reduction of NAD. QUESTION 15 Which of the following statements about viruses is false? Viruses contain a protein coat. Viruses have genes. Viruses contain DNA or RNA but never both. Viruses...
8- D Question 7 6 pts Regarding the serological test, which of the following are true...
8-
D Question 7 6 pts Regarding the serological test, which of the following are true statements: The test can potentially inform when social distancing is no longer needed because it detects how many people are already immune to the disease. The test can detect whether the infection is active or inactive The test gives false positives when exposed to dengue and other coronaviruses' antibodies. The test available shows fluorescence when antibodies present in blood extracted detect the spike protein...
Please classify each statement as describing transformation, conjugation, or transduction in bacteria. Bacteria can acquire plasmids from outside the cell. A bacterium that contains an F plasmid connects to a recipient bacterium that lacks an F plasmid with an appendage called a pilus, through which the plasmid is transferred. Some bacterial DNA fragments may be included when new phage particles are assembled. A cell can be treated to make it competent to take up DNA from its environment. When a...
t Question 14 0/2 pts Which of these statements is about bacterial and viral genomes is true? Bacterial genomes are always DNA, while some viral genomes are made from RNA. Bacterial genomes contain information used to make proteins, while viral genomes do not. Bacterial genomes do not contain information used to make proteins, while viral genomes do. Bacterial genomes are always DNA, while some viral genomes are made from protein.
QUESTION 42 Protein A is a viral protein of 100 amino acids. Protein B is a viral protein of 500 amino acids. Which of the following is true concerning these two proteins? Protein B has more epitopes than protein A Protein A has less chance to be recognized by the host antibodies Protein B can activate more B cell clones than protein A during clonal selection All of the above QUESTION 41 Which one of these statements is true? Neurons...
UPCRISULAPIULULUIJM 4 Question 6 What are some differences between both, Sherlock and RT-PCR, AND the serological test? Serological tests allow to detect individuals currently with the disease and that had the disease in the past. Serological tests require blood samples while the others can use nasal secretions. Serological tests detect human antibodies against COVID19 while the other tests detect viral genes. Serological tests detect viral genome while the other tests focus on viral RNA Question 7 6 p Regarding the...
QUESTIONS During replication the protein that keeps the two stands of DNA from popping back together is called Gene Semiconservative SSB Single Stranded Binding Protein ODNA polymerase QUESTION 2 Tachnow molecule of DNA is a double he which is made up of O two new stands of DNA one new strand and one old strand of DNA two old stands of DNA o the new strands of DNA QUESTIONS QUESTION 19 The process of synthesizing RNA from a specific sequence...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
Chapters 7, 8, 9 - Bacterial Growth & Metabolism (some chapter sections will be covered in lab) Prerequisite: Basic catabolic pathways (respiration and fermentation) and anabolic reactions (photosynthesis) BACTERIAL GROWTH AND CONTROL- Some of these topics will be covered in greater detail during lab Environmental Growth Factors 1. Discuss the specific role of quorum sensing in biofilm formation Control of Microbial Growth 2. Describe the methods used to control microbial growth 3. List the types of antibiotics that inhibit (a)...
QUESTION 13 Genetic change in bacteria can be brought about by Transduction. Mutation. Transformation. Conjugation. All of the above. ooo QUESTION 14 All of the following pertain to glycolysis except occurs without oxygen. ends with formation of pyruvic acid. occurs during fermentation. degrades glucose to CO2 and H20. involves reduction of NAD. QUESTION 15 Which of the following statements about viruses is false? Viruses contain a protein coat. Viruses have genes. Viruses contain DNA or RNA but never both. Viruses...
8-
D Question 7 6 pts Regarding the serological test, which of the following are true statements: The test can potentially inform when social distancing is no longer needed because it detects how many people are already immune to the disease. The test can detect whether the infection is active or inactive The test gives false positives when exposed to dengue and other coronaviruses' antibodies. The test available shows fluorescence when antibodies present in blood extracted detect the spike protein...
Most questions answered within 3 hours.
-
Consider a 3m x 3m window in a house. The thermal conductivity
is reported to be...
asked 14 minutes ago -
Why has California been the favorite destination of large number
of secondary migrants?
asked 47 minutes ago -
Do not neglect the old for the new. The existing business must
not lose priority simply...
asked 3 hours ago -
Kylie is a single mom with two dependent children,
Tanner, age 7 and Olivia, age 11....
asked 5 hours ago -
Phosphorous + bromine = phosphorous tribromide. If 35.0 g of
bromine are reacted and 27.9 grams...
asked 6 hours ago -
Derive the long wavelength limit of the Planck energy density
distribution
asked 6 hours ago -
Calculate the pH of each of the following solutions.
0.50 M HBr
3.1×10−4 M KOH
4.2×10−5...
asked 10 hours ago -
For the year ended December 31, Depot Max’s cost of merchandise
sold was $85,600. Inventory at the...
asked 10 hours ago -
Week 10 - Professional Memo Assignment
Professional Memo Assignment
Your mission for this week, should you...
asked 10 hours ago -
Write a Python program that stores the data for each
player on the team, and it...
asked 10 hours ago -
In
the last 3 months, mike never knows when he is going to get his
allowance...
asked 10 hours ago -
Is Ca(OH)2 a Bronsted base, Lewis base, or both? Why?
asked 10 hours ago