1. An auxotrophic E. coli strain requires adenine to grow because of a mutation in a...
You have a strain of E. coli which is ade- (adenine minus, meaning unable to make adenine on its own). In the biosynthesis of adenine, there are five steps as follows: In the biosynthetic pathway shown above, the ‘precursor’ is the starting material. Enzyme 1 converts this precursor to compound 1 (intermediate 1), enzyme 2 then acts on compound 1 to give rise to compound 2 (intermediate 2), so on and so forth, until enzyme 5 gives rise to the...
As a student project, you have isolated six new mutant strains
of E. coli with altered behavior of the lactose operon. The strains
are listed in the table below, together with their phenotypes (with
regard to significant ?-galactosidase synthesis) in three specific
situations.
Columns 1 and 2 present the phenotypes of each mutant haploid
strain. In column 1, the mutant is in an otherwise wild-type
genome. In column 2, the genome also carries a nonsense-suppressor
mutation (that is not present...
3. Consider a hypothetical strain of E. coli (strain 401) that contains two mutations that affect tryptophan biosynthesis. The first mutation is a single nucleotide substitution that converts the second tandem Trp codon in region 1 of the Trp leader sequence into a stop codon (see slides 2-7 of Lecture 24 on iLearn) trp structural genes trpE trpD trpC trpB trpA PO Trp Leader Met-Lys-Ala-lle-Phe-Val-Leu-Lys-Gly-Trp-Trp-Arg-Thr Ser- Stop Assume that strain 401 also contains a mutation in the gene for the...
A mutant yeast strain is found with a mutation affecting some of its tRNA Tyr. The wild type normally produces a tRNA that recognizes the codon 5’ UAC 3’, and is charged with the amino acid Tyrosine (Tyr) (its notation is tRNATyr). The mutant tRNA is still charged with Tyr, but the anticodon is mutated and now has the sequence 5’- UUA3’. How will some of the proteins produced in these yeast cells be different from the wild type proteins?
2. You have identified a mutant E. coli strain that cannot synthesize histidine (His). To determine the location of the his mutation on the E. coli chromosome, you perform interrupted mating experiments with 5 different Hfr strains. The following chart shows the time of entry (minutes, in parentheses) of the wild-type alleles of the first 5 markers (mutant genes) into the His strain. + + Hfr A. Hfr B Hfr CH Hfr D. Hfr E- his (3) cys (11)- arg...
1) Below is the DNA coding strand of the most common promoter in bacteria. The transcription start site is in bold (+1). Draw boxes around and label the consensus sequences found in this type of promoter. 5' AGTTAGGTATTGACATGATAGAAGCACTCTACTATAATTCAATAGGTCCAC 3 2) A partial peptide sequence for the wild type and three mutant alleles of a gene, PET1, are shown below. Each mutant was caused by a substitution, addition, or deletion of a single nucleotide. Determine the exact coding DNA sequence of...
Please note that Questions 15 to 17 are connected
questions.
Question 15:
The following shows a partial DNA sequence from the wild-type
(normal) allele for the human leukemia-linked apoptotic
gene.
5' ATGCGATTAATCGGTAAA 3' (non-template strand)
3' TACGCTAATTAGCCATTT 5' (template strand)
Please answer the following questions:
(a) If the bottom strand serves as the DNA template for
transcription, what is the resulting mRNA sequence?
The mRNA sequence is 5' 3'. (2
marks)
5' AUG CGA UUA AUC GGU AAA 3' ?
Please enter...
Three different strains of E. coli carry a mutation in the lac operon and/or laci gene. The production of B-galactosidase (+ present or - absent) is measured when lactose is present and absent from the medium. Assume the mutations involve only 1, 0, or Z. A merodiploid is constructed for each of the three strains. The plasmid carries a wild type lac operon and lacl gene. The production of functional B-galactosidase (+ present or - absent) is measured when lactose...
Four auxotrophic mutant strains of E. coli (1, 2, 3, 4) are each blocked at a different step of the same metabolic pathway. This pathway involves compounds L, M, N, O, and P. Each of these compounds is tested for its ability to support growth of mutant strains, with the results given below. (+= growth, __ = no growth) Compound Used as a Supplement L M N O P Mutant 1 + __ + + __ Mutant 2 __ __...
1.The His- phenotype of an Salmonella strain is caused by a single-nucleotide deletion. For this strain, we can expect to find His+ revertants after treatment with: Group of answer choices A.X-rays B. Acridine orange (intercalating agent) C. Nitrous acid (deaminating agent) D. This mutation is very unlikely to be reverted 2) The His- phenotype of an Salmonella strain is caused by a transition mutation. For this strain, we can expect to find His+ revertants after treatment with: Group of answer...