Question

1. An auxotrophic E. coli strain requires adenine to grow because of a mutation in a gene for an adenine synthesis enzyme. Th
0 0
Add a comment Improve this question Transcribed image text
Answer #1

December Week 49 50 51 52 Monday 31 3 10 17 24 Tuesday. 4 11 18 25 Wednesday 5 12 19 26 Thursday 6 13 20 27 Friday 7 14 21 Sa6 November Week 44 45 46 47 Monday 5 12 19 Tuesday Wednesday 7 14 21 Thursday 1 8 15 22 Friday 2 9 16 23 Saturday 3 10 17 24

Add a comment
Know the answer?
Add Answer to:
1. An auxotrophic E. coli strain requires adenine to grow because of a mutation in a...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • You have a strain of E. coli which is ade- (adenine minus, meaning unable to make...

    You have a strain of E. coli which is ade- (adenine minus, meaning unable to make adenine on its own). In the biosynthesis of adenine, there are five steps as follows:             In the biosynthetic pathway shown above, the ‘precursor’ is the starting material. Enzyme 1 converts this precursor to compound 1 (intermediate 1), enzyme 2 then acts on compound 1 to give rise to compound 2 (intermediate 2), so on and so forth, until enzyme 5 gives rise to the...

  • As a student project, you have isolated six new mutant strains of E. coli with altered...

    As a student project, you have isolated six new mutant strains of E. coli with altered behavior of the lactose operon. The strains are listed in the table below, together with their phenotypes (with regard to significant ?-galactosidase synthesis) in three specific situations. Columns 1 and 2 present the phenotypes of each mutant haploid strain. In column 1, the mutant is in an otherwise wild-type genome. In column 2, the genome also carries a nonsense-suppressor mutation (that is not present...

  • 3. Consider a hypothetical strain of E. coli (strain 401) that contains two mutations that affect...

    3. Consider a hypothetical strain of E. coli (strain 401) that contains two mutations that affect tryptophan biosynthesis. The first mutation is a single nucleotide substitution that converts the second tandem Trp codon in region 1 of the Trp leader sequence into a stop codon (see slides 2-7 of Lecture 24 on iLearn) trp structural genes trpE trpD trpC trpB trpA PO Trp Leader Met-Lys-Ala-lle-Phe-Val-Leu-Lys-Gly-Trp-Trp-Arg-Thr Ser- Stop Assume that strain 401 also contains a mutation in the gene for the...

  • A mutant yeast strain is found with a mutation affecting some of its tRNA Tyr. The...

    A mutant yeast strain is found with a mutation affecting some of its tRNA Tyr. The wild type normally produces a tRNA that recognizes the codon 5’ UAC 3’, and is charged with the amino acid Tyrosine (Tyr) (its notation is tRNATyr). The mutant tRNA is still charged with Tyr, but the anticodon is mutated and now has the sequence 5’- UUA3’. How will some of the proteins produced in these yeast cells be different from the wild type proteins?

  • 2. You have identified a mutant E. coli strain that cannot synthesize histidine (His). To determine...

    2. You have identified a mutant E. coli strain that cannot synthesize histidine (His). To determine the location of the his mutation on the E. coli chromosome, you perform interrupted mating experiments with 5 different Hfr strains. The following chart shows the time of entry (minutes, in parentheses) of the wild-type alleles of the first 5 markers (mutant genes) into the His strain. + + Hfr A. Hfr B Hfr CH Hfr D. Hfr E- his (3) cys (11)- arg...

  • 1) Below is the DNA coding strand of the most common promoter in bacteria. The transcription...

    1) Below is the DNA coding strand of the most common promoter in bacteria. The transcription start site is in bold (+1). Draw boxes around and label the consensus sequences found in this type of promoter. 5' AGTTAGGTATTGACATGATAGAAGCACTCTACTATAATTCAATAGGTCCAC 3 2) A partial peptide sequence for the wild type and three mutant alleles of a gene, PET1, are shown below. Each mutant was caused by a substitution, addition, or deletion of a single nucleotide. Determine the exact coding DNA sequence of...

  • Please note that Questions 15 to 17 are connected questions. Question 15: The following shows a...

    Please note that Questions 15 to 17 are connected questions. Question 15: The following shows a partial DNA sequence from the wild-type (normal) allele for the human leukemia-linked apoptotic gene.   5' ATGCGATTAATCGGTAAA 3' (non-template strand) 3' TACGCTAATTAGCCATTT 5' (template strand) Please answer the following questions: (a) If the bottom strand serves as the DNA template for transcription, what is the resulting mRNA sequence? The mRNA sequence is  5'  3'. (2 marks) 5' AUG CGA UUA AUC GGU AAA 3' ? Please enter...

  • Three different strains of E. coli carry a mutation in the lac operon and/or laci gene....

    Three different strains of E. coli carry a mutation in the lac operon and/or laci gene. The production of B-galactosidase (+ present or - absent) is measured when lactose is present and absent from the medium. Assume the mutations involve only 1, 0, or Z. A merodiploid is constructed for each of the three strains. The plasmid carries a wild type lac operon and lacl gene. The production of functional B-galactosidase (+ present or - absent) is measured when lactose...

  • Four auxotrophic mutant strains of E. coli (1, 2, 3, 4) are each blocked at a...

    Four auxotrophic mutant strains of E. coli (1, 2, 3, 4) are each blocked at a different step of the same metabolic pathway. This pathway involves compounds L, M, N, O, and P. Each of these compounds is tested for its ability to support growth of mutant strains, with the results given below. (+= growth, __ = no growth) Compound Used as a Supplement L M N O P Mutant 1 + __ + + __ Mutant 2 __ __...

  • 1.The His- phenotype of an Salmonella strain is caused by a single-nucleotide deletion. For this strain,...

    1.The His- phenotype of an Salmonella strain is caused by a single-nucleotide deletion. For this strain, we can expect to find His+ revertants after treatment with: Group of answer choices A.X-rays B. Acridine orange (intercalating agent) C. Nitrous acid (deaminating agent) D. This mutation is very unlikely to be reverted 2) The His- phenotype of an Salmonella strain is caused by a transition mutation. For this strain, we can expect to find His+ revertants after treatment with: Group of answer...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT