Question

4 Questions below are all connected to each other. PLEASE answer all of them so I...

4 Questions below are all connected to each other. PLEASE answer all of them so I can understand...

1. Make up a transmembrane segment sequence (by using one letter amino acid code) of a protein.

-> ITLIYFGVMAGVIGTILLIS <= This is what I made. Is this correct transmembrane segment sequence?

2. Make an amino acid sequence (by using one letter amino acid code) that bind to Bi. <= For this question, you just need to make own amino acid sequence

3. Why would you expect that BiP would not bind to sequence (your made up amino acid sequence from Q2) under “normal circumstances” in cell.

4. Give an example of a situation where BiP would be expected to bind your made-up protein (your made up amino acid sequence from Q2) in cell.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

(Q: nu: 1). Transmembrane pooteins are integral proobin which helps damagandi of materials across the cell membrane At hydoop

Add a comment
Know the answer?
Add Answer to:
4 Questions below are all connected to each other. PLEASE answer all of them so I...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Please help and do all questions please Fill in the blanks in the table so as...

    Please help and do all questions please Fill in the blanks in the table so as to match the membrande described with the organism having such an membrane: (A) a bacterium living in a compost heap (at a temperature of 50 °C), (B) a (cold blooded) fish living in arctic waters, (C) an oak tree growing in a temperate forest during the spring. and (D) a pathogenic yeast infecting a (warm blooded) mammal (8 points) Fatty Acid Fatty Acid sacrel...

  • 4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is...

    4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...

  • Please note that Questions 15 to 17 are connected questions. Question 15: The following shows a...

    Please note that Questions 15 to 17 are connected questions. Question 15: The following shows a partial DNA sequence from the wild-type (normal) allele for the human leukemia-linked apoptotic gene.   5' ATGCGATTAATCGGTAAA 3' (non-template strand) 3' TACGCTAATTAGCCATTT 5' (template strand) Please answer the following questions: (a) If the bottom strand serves as the DNA template for transcription, what is the resulting mRNA sequence? The mRNA sequence is  5'  3'. (2 marks) 5' AUG CGA UUA AUC GGU AAA 3' ? Please enter...

  • please help with these. if you answer all of them I'll be sure to give a...

    please help with these. if you answer all of them I'll be sure to give a thumbs up. please explain them so I can understand them, especially 28 and 26. thanks! 13. What would be the MOST likely effect of mutating the consensus sequence found at the 5' splice site of an intron? 1. A longer than normal mRNA would be produced. 2. A shorter than normal protein would be produced. 3. A longer than normal DNA would be produced....

  • Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...

    Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...

  • Please provide justifications for all answers so I understand. Extra detail is very helpful. Thank you...

    Please provide justifications for all answers so I understand. Extra detail is very helpful. Thank you so much. Question 1 [7pts] A. The following DNA sequence contains an open reading frame that codes for an 8 amino acid protein. Which open reading frame (1, 2 or 3) would need to be translated to yield that protein? (1pt) TAATGTATATCCCACGGTATGGAGTTTAAG B. In the frame you chose, give an example of a silent mutation at the third amino acid. (2pt) C. Now give...

  • 6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence,...

    6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence, the tRNA anticodons, and the amino acid sequences (use the three letter code) that would result from it. (3 points) DNA +1 15'GICIA I G C A A CICATI I AA GG 3' 3" CA GATA C GTIGA GIA A A IICC 5 mRNA tRNA anticodons amino acids 7. You are interested in a gene that codes for a 20 amino acid-long protein. (1.5...

  • please explain answer to number 4 and 5 NATIONAL CENTER FOR CASE STUDY TEACHING IN SCIENCE...

    please explain answer to number 4 and 5 NATIONAL CENTER FOR CASE STUDY TEACHING IN SCIENCE Part II - Song Titles Let's continue with our music analogy by reading a short gene, turning it into mRNA sequence (transcription), and then tuming the mRNA sequence into a protein (translation), which will give us a song title. This will be a small protein, which is often referred to as a "peptide." There are many peptides that are important in biological systems. Some...

  • tcaggctttaattcatccgtgatctttgacgacggtaaatacgatgcagatataatacgatgaccgatgccaatcgaccgatcaaggaggcaccgaatggcgatgatggcgatgattgcgattaacgaagtggaacgcattatggcgggcattaacgaagatacccatgcgaccggcgaaaacgaaaccatttgcagctgcgcgaactttgaagaactgacccatgcgaccggccgcgaagcgacctaaaagtcg

    tcaggctttaattcatccgtgatctttgacgacggtaaatacgatgcagatataatacgatgaccgatgccaatcgaccgatcaaggaggcaccgaatggcgatgatggcgatgattgcgattaacgaagtggaacgcattatggcgggcattaacgaagatacccatgcgaccggcgaaaacgaaaccatttgcagctgcgcgaactttgaagaactgacccatgcgaccggccgcgaagcgacctaaaagtcgtaattacgtatcaagtcatgggccgcgggcgcccggcccactgactagactagggccgggcgcccgcggcccaccatataaataaaaaaaaaaaaaacgaggctatagctcatcaatgacct Your job now is to copy the above DNA sequence and highlight each of the different sequence elements that are relevant to this particular gene (I suggest that you use different font backgrounds for each sequence element) and briefly explain what each of them do . Then, write the sequence of the mRNA that would be transcribed from this DNA sequence, identifying the AUG and STOP codon (I suggest that you bold and underline text this time). Once you've...

  • Complete the following table and answer the next two questions (3.5 marts) 10 B I =...

    Complete the following table and answer the next two questions (3.5 marts) 10 B I = U Ꭶ X2 x E I 19 эс ✓ C Finis DNA strand G C А DNA strand TAC TAC mRNA codon AUG C G G tRNA anticodon G - Amino acid Tryptophan Stop mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides corresponds to an amino acid in the protein that gets built...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT