Question

NATIONAL CENTER FOR CASE STUDY TEACHING IN SCIENCE Part II - Song Titles Let's continue with our music analogy by reading a short gene, turning it into mRNA sequence (transcription), and then tuming the mRNA sequence into a protein (translation), which will give us a song title. This will be a small protein, which is often referred to as a "peptide." There are many peptides that are important in biological systems. Some peptides are even used therapeutically as drugs or dietary substitutes. The artificial sweetener, apartame, is a di-peptide consisting of aspartic acid (abbreviated "D" for short) and phenylalanine (abbreviated "P"). Here's the template strand of the gene: 3' TACCTCGCAACAATGATC 5' Questions 1. Each "letter" represents a DNA nucleotide. How many nucleotides are in this gener 2 Perform the process of transcription on this gene, using the DNA sequence to build the complementary mRNA sequence (remember that RNA uses the nucleotide uracil paired with adenine instead of thymine) 5 AUG GAG CGU UGU vac vaG 3 3. Each three-letter group is one codon. Starting with the AUG, how many codons are in this gene? 4. Now, perform the process of translation on this mRNA, using the mRNA sequence to construct the appropriate protein sequence using the genetic code (see Table 1. p. 2 above). This table shows amino acids using their 3- and 1-letter abbreviations, and which codons they are associated with. For this step, use the 1-letter abbreviation. If you do this correctly, you should get the title of a 2015 song from the British band Muse: I proteiny MET GLU ARG CYS TYR Stop Next, you will choose 1 song title (representing a peptide), to create a complementary mRNA and then a DNA sequence going in the reverse direction as above. Here is a list of song titles that begin with the letter "M." MACARENA MANHATTAN MADNESS MASTERPIECE MAGNIFICIENT MIRACLES MIGRAINE MAGGIE MERCENARY MIDNIGHT MACHETE MACHINES MAGNETIC MAINSTREET MANDINKA MANEATER MYSTIFY MICHELLE 5. Using the genetic code, find a three-letter codon for each letter of your peptide song title. Write down each of these codons below (in order to create an mRNA for your peptide. Keep in mind that for some letters/amino acids, there are multiple codons you can choose. That is okay, just choose one. Also, don't forget a stop codon at the end! Write this mRNA for your peptide song title here: 3 5' Page 4 "The Sound of DNA" by De Souza-Hart and DeMasi

please explain answer to number 4 and 5

Answer 1

4. There is a codon table which shows which codon will be translated into which amino acid. AUG codes for methionine, GAG codes for Glutamic acid, CGU codes for Arginine, UGU codes for cysteine, UAC codes for Tyrosine and UAG codes for stop codon. So the translated sequence is Met Glu Arg Cys Tyr Stop.

The one letter abbreviation for this sequence is M E R C Y. So this is the song by British band Muse.

5. I am choosing the song MAGGIE. M is methionine (AUG) A is alanine (GCG) G is glycine(GGG) G is glycine(GGA) I is isoleucine(AUA) E is glutamic acid(GAG)

So the mRNA sequence is 5' AUGGCGGGGGGAAUAGAGUAG 3'

So the DNA sequence is 3' TACCGCCCCCCTTATCTCATC 5'