Part b: -
In DNA replication process, from one DNA double helix (two parents strands), another DNA double helix is created (two new strands). During the DNA replication process Adenine (A) is combined with Thymine (T) by two hydrogen bonds and Guanine (G) is combined with cytosine (C) with three hydrogen bonds. As the name suggests in the replication process exact copy of DNA is produced.
Parent strand |
New strand |
Parent strand |
New strand |
A |
T |
T |
A |
T |
A |
A |
T |
G |
C |
C |
G |
G |
C |
C |
G |
C |
G |
G |
C |
T |
A |
A |
T |
A |
T |
T |
A |
G |
C |
C |
G |
Here green color represents the parent strand and violet color represents the new strand.
9. a. In the box A below, fill in the complementary strand of DNA to create...
Hellesse ah vertanian Period: DNA Replication Worksheet Complete all of the following: ou Stand 3 105 1. Identify and label the letter X.509 2. Identify and label the letter Y Phone 3. Label and color all bases with the appropriate letter and color. Color code your key to match. 4. Identify and label the parent strands. 5. Identify the replication fork and add the enzyme helicase to the area where this is happening 6. Look at the area labeled with...
In the diagram below, you are provided with a known sequence of DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL LETTERS (e.g., GGCGGT), and work your way from the top to the bottom. A) Fill in the complementary DNA bases for DNA Strand 2 to form a complete double-stranded DNA molecule. B) Create an mRNA strand that is complementary to DNA Strand 1. C) Using the mRNA sequence that you just created, determine the complementary...
2 [Type text] 3. Using this strand of DNA: AATACCGATACGGGGCAACTAAA a. Create the complementary DNA strand (1 pts.) b. Create the complementary mRNA strand (from the original strand) (2 pts) c. Create the protein (refer to Table 1 on page 3 as needed) (2 pts.)
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...
The sequence below is found in a DNA double helix. Fill in the complementary strand and include which ends are 5' and which ends are 3'. 5°- TTGACGGTTAA-3 3 - AACT GCC AATT-5 B) In the strand that you filled in above, circle the nucleotide(s) that has/have a free phosphate group
Replicate the DNA strand below and create a complementary strand. Remember that complementary bases will always match with each other Adenine--Thymine and Cytosine--Guanine. AGCCCGTCTTGGAAT
Give the sequence of the complementary strand of the following DNA of one DNA strand of a DNA double helix is the (6 pts) nd of the following DNA strands. The nucleotide sequence a. 5'-GGATTTTTGTCCACAATCA-3' b. 3'-TTCGAGTCCAAGTCGTACTA-S or magnesium chloride (MgCl) is dissolved in 2.40 L of water. (Molar mass of MgCl2 -.11g/mole) (15 pts) a. What is the molarity of solution? b. How many moles of MgCl, are contained in 1.76L of solvent? C. How many liters of solvent...
How DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? 5. What is DNA replication?, 6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order. a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. b. The DNA double helix breaks or unzips down the middle between the base pairs. C. A complementary strand...
For the following DNA strand: ATTTTAAGCTAAGCTCCA (a) Write the complementary strand, (b) Calculate the number of hydrogen bonds existing between the strands, (c) Specify the 5’ and 3’ ends for each strand.
This PCR step is called annealing. The annealing step follows the denaturation step: it is usually the lowest temperature in the PCR. The temperature of this step varies with each PCR reaction because each primer has its own sequence and may not be an identical match to the DNA template strand. GC or CG have three hydrogen bonds and AT or TA have two hydrogen bonds. Higher annealing temperatures are more stringent and require a better match between primer and...