For the following single-stranded DNA molecule: 3’ – G T A C A A G T...
For the following single-stranded DNA molecule: 3’ – G T A C A A G T C A – 5’
1. Write the complementary strand, being sure to label polarity. (2 pts)
2. What is the GC content for the resulting double-stranded DNA molecule? (2 pts)
Homework Answers
ANS.1-
Template Strand : 3'-G T A C A A G T C A-5'
Complementary Strand : 5'-C A T G T T C A G T-3'
ANS.2-
GC content - 40%
Add Answer to:
For the following single-stranded DNA molecule: 3’ – G T A C A A
G T...
5) (3 pts) For a double-stranded DNA molecule, which of the following statements are true? If...
5) (3 pts) For a double-stranded DNA molecule, which of the following statements are true? If false, explain why. a. [A+C] = [G+T] b. [A+G] = [C+T) c. A=G and C=T d. A/T=C/G e. [A+T] = [G+C] f. C/A=T/G 6) (3 pts) Listed below are the base compositions of three different duplex DNA molecules. L S'ATTCTAACTTTGAT 3' 3' TAAGATTGAAACTA 5 IL S'CGCACTGGCTAACC 3' 3'GCGTGACCGATTGG 5' II. 5'CGCATTATTGTCAA 3' 3'GCGTAATAACAGTT 5' a) Order these three molecules in terms of their melting...
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10 The form of genetic reco...
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10 The form of genetic recombination that allows movement of genetic elements from one DNA site to another is termed: O A site-specific recombination O B. homologous recombination ° C. branch migration D.transposition
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10...
DNA is a double-stranded molecule where two polynucleotide strands run antiparallel to each other, and the...
DNA is a double-stranded molecule where two polynucleotide strands run antiparallel to each other, and the bases on one strand are complementary to the bases on the opposite strand. If one strand of a DNA molecule has the following sequence of bases, what would the sequence be for the complementary, antiparallel DNA strand? 3' GCTGATCAGGAC 5'
A segment of a double-stranded DNA molecule is shown below. The start of a gene is...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
DNA is double stranded, but only one strand is used as a template for transcription. How...
DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...
1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a....
1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a. If the DNA contains 28% adenosine residues, how many guanosine residues are in the DNA? b. Are the nucleotide compositions of each of the two individual strands of DNA identical? Explain. c. If the DNA is entirely in the B-DNA conformation: i. How many helical turns does the DNA contain? ii. What is the length of the DNA? 2. Write the sequence of a...
Part C this is for Genetics UUUUUUUUUUUUUUPPO 1 (UU (AA (CA 44. A double-stranded DNA molecule...
Part C
this is for Genetics
UUUUUUUUUUUUUUPPO 1 (UU (AA (CA 44. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT (UA (AL a. Which strand of DNA is the template strand, and in which direction is it transcribed? b. Label the 5' and the 3' ends of each strand. c. If an inversion occurs between the second and the third triplets from the left and right...
In the diagram below, you are provided with a known sequence of DNA (DNA Strand 1)....
In the diagram below, you are provided with a known sequence of
DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL
LETTERS (e.g., GGCGGT), and work your way from the top to the
bottom.
A) Fill in the complementary DNA bases for DNA Strand 2 to form a
complete double-stranded DNA molecule.
B) Create an mRNA strand that is complementary to DNA Strand
1.
C) Using the mRNA sequence that you just created, determine the
complementary...
The partial sequence of one strand of a double stranded DNA molecule is: 5’ ---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG--- 3’...
The partial sequence of one strand of a double stranded DNA molecule is: 5’ ---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG--- 3’ Write the sequence of both strands of the DNA fragment when this DNA is cleaved with both EcoRI and PstI. The top of your duplex DNA fragment should be derived from the standard sequence given above.
5) The following sequence of nucleotides is found in a single-stranded DNA template: (3 pts) ...
5) The following sequence of nucleotides is found in a single-stranded DNA template: (3 pts) ATTGCCAGATCATCCCAATAGAT Label the 5’ and 3’ ends of the DNA template. (1 pt) b) Give the sequence and label the 5’ and 3’ ends of the RNA transcribed from this template. (2 pts)
5) (3 pts) For a double-stranded DNA molecule, which of the following statements are true? If false, explain why. a. [A+C] = [G+T] b. [A+G] = [C+T) c. A=G and C=T d. A/T=C/G e. [A+T] = [G+C] f. C/A=T/G 6) (3 pts) Listed below are the base compositions of three different duplex DNA molecules. L S'ATTCTAACTTTGAT 3' 3' TAAGATTGAAACTA 5 IL S'CGCACTGGCTAACC 3' 3'GCGTGACCGATTGG 5' II. 5'CGCATTATTGTCAA 3' 3'GCGTAATAACAGTT 5' a) Order these three molecules in terms of their melting...
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10 The form of genetic recombination that allows movement of genetic elements from one DNA site to another is termed: O A site-specific recombination O B. homologous recombination ° C. branch migration D.transposition
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...
1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a. If the DNA contains 28% adenosine residues, how many guanosine residues are in the DNA? b. Are the nucleotide compositions of each of the two individual strands of DNA identical? Explain. c. If the DNA is entirely in the B-DNA conformation: i. How many helical turns does the DNA contain? ii. What is the length of the DNA? 2. Write the sequence of a...
Part C
this is for Genetics
UUUUUUUUUUUUUUPPO 1 (UU (AA (CA 44. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT (UA (AL a. Which strand of DNA is the template strand, and in which direction is it transcribed? b. Label the 5' and the 3' ends of each strand. c. If an inversion occurs between the second and the third triplets from the left and right...
In the diagram below, you are provided with a known sequence of
DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL
LETTERS (e.g., GGCGGT), and work your way from the top to the
bottom.
A) Fill in the complementary DNA bases for DNA Strand 2 to form a
complete double-stranded DNA molecule.
B) Create an mRNA strand that is complementary to DNA Strand
1.
C) Using the mRNA sequence that you just created, determine the
complementary...
Most questions answered within 3 hours.
-
Oxidative phosphorylation is achieved through chemiosmotic
coupling, which turns chemical energy into osmotic potential energy
that...
asked 50 minutes ago -
Hollywood Shoes would like to maintain their cash account at a
minimum level of $64,000, but...
asked 49 minutes ago -
Proteins CtrA-P, DnaA, and GcrA behave similarly to what
molecule in the Eukaryotic Cell Cycle?
asked 53 minutes ago -
TRUE OR FALSE
In case of a competitive tender procedure, in the request for
quotation, the...
asked 1 hour ago -
I am a little behind please provide some explanation, will
provide thumbs up.
This question considers...
asked 1 hour ago -
Let say the utility function as U(X,Y) = lnX + Y. Show that the
marginal rate...
asked 1 hour ago -
A current of I=8.0A is flowing in a typical extension cord of
length L=3.00m. The cord...
asked 1 hour ago -
1. When balancing the equation H2SO4 (aq) + NaOH (aq) →
Na2SO4(aq) + H2O(aq), would you...
asked 1 hour ago -
Provide a definition of “classification hierarchy” and
illustrate your definition with an example of how and...
asked 1 hour ago -
1. Describe the four main green solvents. Provide one example of
the use of each solvent....
asked 1 hour ago -
International ethics focus on:
1) exploitation of labor
2)corruption
3) environmental impact
4) none of the...
asked 1 hour ago -
Costing Models You work for XYZ trucking and your boss has asked
you to figure out...
asked 1 hour ago