Answer - bottom strand 5'-3' right to left
The template strand from mRNA transcribed would be from the bottom strand 5'-3' because the tRNA reads in the sequence of 3'-5' on their anticodon loop so to synthesize mRNA From that it will form template in opposite direction
4. The following is a small stretch of DNA sequence from middle of a bacterial open...
The following is a small stretch of DNA sequence from middle of a bacterial open reading frame that encodes a protein that is 450 amino acids in length : 5’-GCCTACTCTATGTTTACATCTGTGCTACGC – 3’ 3’-CGGATGAGATACAAATGTAGACACGATGCG – 5’ A) Which of the strands is the template strand for the mRNA that is transcribed from this DNA (“top strand” 5’ to 3’ left to right or “bottom strand” 5’ to 3’ right to left)? B) What is the basis for your answer to part...
4. Given the following information: One strand of a section of DNA isolated from E. coli reads 5’-GTAGCCTACCCATAGG-3’ 3’ CATCGGATGGGTACC’5 Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be (please include orientation)? How many different polypeptides chains could potentially be made from this sequence of RNA? Would the same polypeptide chains be made if the other strand of the DNA...
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
If in fact this small sequence derives from somewhere in the middle of a CDS, then the coding strand (AKA, "sense" strand) must be the one which is written in ____ font Once the open reading frame has been identified, the 23 nucleotides of the coding strand above can be translated into seven complete codons plus two nucleotides which comprise parts of some unknown codon(s). Ignoring the two extra nucleotides, the first* complete in-frame codon in this short chain of...
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...
The DNA sequence shown encodes the last amino acids of a protein that has a total of 270 amino acids. The bolded base pairs indicate the translation reading frame. 5’ …….GCT AAG TAT TGC TCA AGA TTA GGA TGA TAA ATA ACT TGG 3’ 3’ …….CGA TTA ATA ACG AGT TCT AAT CCT ACT ATT TAT TGA ACC 5’ Which is the template strand for transcription? Explain.
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of the DNA template strand from which it was transcribed? 2) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?