In an alpha-helical protein that spans the cell membrane, __ would likely be in the center of the membrane while __ would likely be associated with the polar head groups and __ would likely be associated with the aqueous environment.
(a) Trp, Asn, Ala
(b) Leu, Gln, Asp
(c) Tyr, Glu, Glu
(d) Ile, Arg, Gln
I believe the answer to be B or D but I need to explain it. I would think it would be D because the positive charge of Arg would interact with the negative polar heads....... I don't know if this logic holds up. Please help.
Ans. Your notion is correct.
The hydrophobic core (the center of membrane) exerts favorable hydrophobic interactions with hydrophobic (non-polar) amino acid like leucine and isoleucine here. So, either of options B and D are true for this part.
# The polar head groups of the membrane are negatively charged due to presence of phosphate. To exert favorable ionic interactions with negatively charged heads, the amino acid must be positively charged at physiological pH. Among the options B and D, only arginine is positively charged whereas glutamine is neutral. So, among options B and D, option D is most appropriate.
# Glutamine is a polar, uncharged residue, and can interact with the polar aqueous environment through H-bonds.
# So, the correct option is- D.
In an alpha-helical protein that spans the cell membrane, __ would likely be in the center...
Which of these protein sequences is most likely to span a cell membrane? Gly-Asp-Val-Ala-Gly-Arg-Gly-Asn-Gly-Lys-Lys-Pro-Ser-Ser-Val-Arg-Ala-Leu-Ser Ile-Val-Leu-Pro-Ile-Val-Leu-Leu-Val-Phe-Leu-Cys-Leu-Gly-Val-Phe-Leu-Leu-Trp Lys-Asn-Trp-Arg-Leu-Lys-Asn-Ile-Asn-ser-Ile-Asn-Phe-Asp-Asn-Pro-Val-Tyr-Gln A. 773 B. 792 C. 811
How many amino acids are there in the disease causing variant of the Amyloid-beta (Ab) peptide? Determine which of these four peptides is most likely to become a beta sheet. Lys-Thr-Val-Ile-Trp-Pro-Phe-Tyr-Ile-Gln-Ile-Gly Arg-Ser-Tyr-Glu-Gly-Leu-Lys-Arg-Ile-Ala-Glu-Ser Ala-Glu-Met-Leu-Gln-Lys-Arg-Gly-Cys-Gly-Asp-Glu Met-Leu-Lys-Ala-Ser-Ala-Leu-Glu-Lys-Leu-Ser-Glu
Met-Ala-Arg-Tyr-Ala-Asn-Asn-Glu__Lys-Glu-Leu-Leu-Tyr__Arg-Tyr-Ala-Asn__Phe-Leu-Ala-Asn-Asn-Ile-Gly-Ala-Asn__Ile-Ser__Ile-Asn-Thr-Glu-Arg-Glu-Ser-Thr-Glu-Asp__Ile-Asn__ His-Glu-Arg__Phe-Ala-Thr-His-Glu-Arg-Ser__Thr-Arg-Ile-Gly-Leu-Tyr-Cys-Glu-Arg-Ile-Asp-Glu__Leu-Glu-Val-Glu-Leu-Ser__Ser-Ile-Asn-Cys-Glu__His-Glu-__His-Ala-Pro-Pro-Ile-Leu-Tyr__Glu-Ala-Thr-Ser__Val-Ala-Asn-Ile-Leu-Leu-Ala__Cys-Ala-Lys-Glu-__Ala-Asn-Asp__Pro-Glu-Cys-Ala-Asn__Pro-Ile-Glu__Trp-Ile-Thr-His__Phe-Arg-Ile-Glu-Asp__Cys-His-Glu-Glu-Ser-Glu-Cys-Ala-Lys-Glu__Ile-Cys-Glu__Cys-Arg-Glu-Ala-Met__Glu-Val-Glu-Arg-Tyr-Asp-Ala-Tyr__Ala-Asn-Asp__Ser-His-Glu__Ile-Ser__Asp-Glu-Val-Ala-Ser-Thr-Ala-Thr-Glu-Asp__Thr-His-Ala-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu-Ser__Leu-Ile-Lys-Glu__His-Glu-Ala-Arg-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu__Ser-Leu-Glu-Glu-Pro__Ala-Pro-Asn-Glu-Ala__Ser-Glu-Val-Glu-Arg-Glu__Trp-Glu-Ile-Gly-His-Thr__Gly-Ala-Ile-Asn__Trp-Ile-Leu-Leu__Ala-Arg-Ile-Ser-Glu__Ile-Phe__His-Glu__Lys-Glu-Glu-Pro-Ser__Thr-His-Ile-Ser__Glu-Ala-Thr-Ile-Asn-Gly__Pro-Ala-Thr-Thr-Glu-Arg-Asn__Tyr-Glu-Thr__Ile-Phe__His-Glu__Trp-Trp-Trp-Trp-Ile-Ile-Ile-Ile-Ile-Leu-Leu-Leu-Leu-Leu-Ser-Ser-Ser-Ser__Cys-His-Ala-Asn-Gly-Glu__Ile-Asn__His-Ile-Ser__Leu-Ile-Phe-Glu-Ser-Thr-Tyr-Leu-Glu__His-Glu__Cys-Ala-Asn__Ser-Thr-Ile-Leu-Leu__Arg-Glu-Met-Ala-Ile-Asn__His-Glu-Ala-Leu-Thr-His-Tyr__Ser-Ala-Ser-Ser-Tyr__Ala-Asn-Asp__Ala-Leu-Arg-IleGly-His-Thr 1.) Write out the 1 letter amino acid abbreviation for each of the three-letter amino acid abbreviated words listed in the given sequence. The __ indicates a space in between the words. Use www.expasy.org and other bioinformatic tools to generate the following bioinformatic data for the given polypeptide sequence. You must give the name and link to the program you used to generate the data: 2.) Compute the pI and Mw (isoelectric point and molecular mass, respectively) of...
Hydrophobic residues usually appear at the first and fourth positions in the seven-residue repeats of polypeptides that form coiled coils. The first and fourth side chains are buried in the coiled coil, but the remaining side chains are exposed to the solvent and therefore tend to be polar or charged. Which of the following sequences is more likely to appear in a coiled coil? 275 0.728 a) Ile-Gln-Glu-Val-Glu-Arg-Asp## 15 0.040 b) Trp-Gln-Glu-Tyr-Glu-Arg-Asp 11 0.029 c) Ile-Gln-Glu-Val-Glu-Ala-Asp 8 0.021 d) Trp-Gln-Glu-Tyr-Glu-Ala-Asp
What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on your protein? Here is the vector: T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...
1. which tripeptide will most likely line the opening of a Cl- channel? a. His-Lys-Arg b. Gly-Pro-Arg c. Asp-Trp-Tyr d. Asp-Ala-Glu e. Leu-Val-Phe 2. Which tripeptide will most likely line the opening of a K+ channel? (consider side chains at physiological pH) a. His-Lys-Arg b. Gly-Pro-Arg c. Asp-Trp-Tyr d. Asp-Ala-Glu e. Leu-Val-Phe
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
20. This sequence is RNA because:A) it is single stranded.B) it contains U (uracil) and no T (thymine).C) it runs in a 5' to 3' direction.D) it codes for amino acids.E) it is a small molecule.21. Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile...B) pro-arg-ala-thr-stopC) met-asn-glu-leu...D) glu-leu-val-val-phe...E) leu-glu-gln-his-asn...22. If the sequence gets changed to 5' ... GGAGACUCGUUGUAUU... 3'. What would be the effect on the amino...
3. A protein contains the following amino acids: O ALA 4 GLN 1 LEU 3 ARG 4 GLU 4 LYS 4 ASN 5 GLY O MET 1 ASP 1 HIS 2 PHE 4 ILE 4 PRO 8 SER 5 THR 1 TRP 2 TYR 2 VAL BGYS. a) What is its net charge at pH 1? b) What is its net charge at PH 13? c) Calculate the pl. 4. In what order would the amino acids GLU, LYS, and...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...