The building of proteins is called
a. |
transcription |
|
b. |
translation |
|
c. |
replication |
|
d. |
coding |
The building of proteins is called a. transcription b. translation c. replication d. coding
1. The figure above represents A. replication B. transformation C. transcription D. translation
Identify the components of replication, transcription, and translation processes. Replication transcription translation DNA polymerase, deoxynucleoside triphosphate, primer, RNA polymerase, nucleoside triphosphate, transfer RNA, ribosome, messenger RNA , promoter, ribosomal RNA
Stem-loop structures are associated with..? a. transcription initiation b. transcription termination c. translation initiation d. translation termination
3. Compare the key players in DNA replication, transcription, and translation by filling out a table such as this one (this is just a template, you will need more space than what’s provided here). Key players Replication Transcription Translation DNA components RNA components Protein components
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...
Summarize the relationship between genes and proteins . Explain the purpose of transcription and translation. Describe the steps of transcription I State the enzyme or structures that perform transcription and translation. Contrast prokaryotic and eukaryotic mRNA . Describe the process of translation .Describe the role of tRNA in translation . Explain the role of codons and anticodons in translation. Explain the significance of stop codons and start codons. Given a double stranded DNA gene sequence, be able to produce the...
Part A What is the process of synthesizing protelins from MRNA sequences? translation replication transcription transformation transduction Request Answer Submit
Define Mendel’s two laws of inheritance Define replication, transcription and translation and provide a general statement about the role each plays in gene expression.
Fill in the diagram below to show the relationship between DNA and proteins. Nucleus Translation Transcription Ribosome