Homework Answers
The answer to the question is first option. The described process is known as replication of DNA. The parental strand is attached with the newly synthesized DNA strand which is differerent from the parental strand and this type of replication is known as semiconservative replication as only one strand of DNA is parental strand and the newly synthesized strand is prone to errors.
Please give a thumbs up if the answer helped you. Thank you! :)
Add Answer to:
1. The figure above represents A. replication B. transformation C. transcription D. translation
The building of proteins is called a. transcription b. translation c. replication d. coding
The building of proteins is called a. transcription b. translation c. replication d. coding
Part A What is the process of synthesizing protelins from MRNA sequences? translation replication transcription transformation...
Part A What is the process of synthesizing protelins from MRNA sequences? translation replication transcription transformation transduction Request Answer Submit
Identify the components of replication, transcription, and translation processes. Replication transcription translation DNA polymerase, deoxynucleoside triphosphate,...
Identify the components of replication, transcription, and translation processes. Replication transcription translation DNA polymerase, deoxynucleoside triphosphate, primer, RNA polymerase, nucleoside triphosphate, transfer RNA, ribosome, messenger RNA , promoter, ribosomal RNA
Stem-loop structures are associated with..? a. transcription initiation b. transcription termination c. translation initiation d. translation...
Stem-loop structures are associated with..? a. transcription initiation b. transcription termination c. translation initiation d. translation termination
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...
3. Compare the key players in DNA replication, transcription, and translation by filling out a table...
3. Compare the key players in DNA replication, transcription, and translation by filling out a table such as this one (this is just a template, you will need more space than what’s provided here). Key players Replication Transcription Translation DNA components RNA components Protein components
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence...
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...
Uluruunu us RJ15 1. Draw or describe the process of eukaryotic transcription and translation, using the...
Uluruunu us RJ15 1. Draw or describe the process of eukaryotic transcription and translation, using the following terms as needed (not all terms will be used): sigma factor, RNA polymerase, DNA polymerase, origin of replication, ribosome, start codon, transcriptional start site, stop codon, nucleus, -10 and -35 sequences, TATA box, TBP, inducer, transcriptional stop site, Shine-Delgrano sequence, Kozak sequence, RNA splicing. 2. Draw or describe the process of prokaryotic/eubacterial transcription and translation, using as many of the terms above as...
1. What is the significance of transcription and translation in overall physiology of Human or bacterial...
1. What is the significance of transcription and translation in overall physiology of Human or bacterial cells? 2. What is transcription? 3. What is translation? 4. What are the differences between Transcription and replication 5. What're the differences between the Transcription and Translation process in human cells versus bacterial cells? 6. What are the functions of RNA polymeraseI, Il and 1lI? 7. What is a promoter and what are the important sequences within a promoter? 8. What is the role...
Define Mendel’s two laws of inheritance Define replication, transcription and translation and provide a general statement...
Define Mendel’s two laws of inheritance Define replication, transcription and translation and provide a general statement about the role each plays in gene expression.
Part A What is the process of synthesizing protelins from MRNA sequences? translation replication transcription transformation transduction Request Answer Submit
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...
3. Compare the key players in DNA replication, transcription, and translation by filling out a table such as this one (this is just a template, you will need more space than what’s provided here). Key players Replication Transcription Translation DNA components RNA components Protein components
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...
Uluruunu us RJ15 1. Draw or describe the process of eukaryotic transcription and translation, using the following terms as needed (not all terms will be used): sigma factor, RNA polymerase, DNA polymerase, origin of replication, ribosome, start codon, transcriptional start site, stop codon, nucleus, -10 and -35 sequences, TATA box, TBP, inducer, transcriptional stop site, Shine-Delgrano sequence, Kozak sequence, RNA splicing. 2. Draw or describe the process of prokaryotic/eubacterial transcription and translation, using as many of the terms above as...
1. What is the significance of transcription and translation in overall physiology of Human or bacterial cells? 2. What is transcription? 3. What is translation? 4. What are the differences between Transcription and replication 5. What're the differences between the Transcription and Translation process in human cells versus bacterial cells? 6. What are the functions of RNA polymeraseI, Il and 1lI? 7. What is a promoter and what are the important sequences within a promoter? 8. What is the role...
Most questions answered within 3 hours.
-
The x component of the velocity of an object vibrating
along the x-axis obeys the equation...
asked 52 minutes ago -
A junction box contains two trade size 2 raceways on the left
side, and two trade...
asked 1 hour ago -
Atmospheric Mass
Venus and Earth have about the same mass and radius, but the
atmospheric pressure...
asked 2 hours ago -
5. Discuss the use of fault tree analysis (FTA) for risk
assessment (maximum one paragraph).
asked 3 hours ago -
Given that a sample of aluminium oxide has a Young's modulus of
393 GPa and a...
asked 4 hours ago -
At a certain temperature, the equilibrium constant, Kc, for this
reaction is 53.3.
H2(g)+I2(g)−⇀↽−2HI(g)Kc=53.3
At this...
asked 5 hours ago -
Question1 ) The STL provides similiar classes called stack and
queue, both of which gave functions...
asked 6 hours ago -
For Questions 1-4, assume you have 5 bits available:
1. For (positive) integers: What is the...
asked 6 hours ago -
convert grams into vloume with the density of water being at
.997514 g/cm^3 at 23.1 Celsuis...
asked 9 hours ago -
Foreman company obtained a $20,000, 6% loan on May 1, 2018.
Principal and interest will be...
asked 9 hours ago -
5. Problem 11.05 (Discounted Payback)
eBook
Project L costs $60,000, its expected cash inflows are $14,000
per...
asked 9 hours ago -
1. Which of the following is true about politics and health
organizations?
A. Health organizations are...
asked 10 hours ago