To answer the question, first of all, we have to understand the processes mentioned above.
1) Translation- Translation is a cellular process in which polypeptide chains or proteins are synthesized by the activity of mRNA and ribosomes. This process is also known as gene expression.
2) Replication- Replication is a process in which synthesis of new DNA occurs from pre existing DNA molecules in a semi conservative manner.
3) Transcription- Transcription is a process where single stranded RNA molecule is synthesized from double stranded DNA molecule. One DNA strand serves as template strand and the other as coding strand.
4) Transformation- Here, bacterial cells uptake exogenous genetic material from its surrounding environment. The exogenous genetic material gets incorporated into the bacterial genome.
5) Transduction- In this process viruses act as vectors by which exogenous genetic material gets incorporated into bacterial cells as they are attacked by the viruses.
Based on the above explanations, the correct option will be TRANSLATION
Part A What is the process of synthesizing protelins from MRNA sequences? translation replication transcription transformation...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...
1. What is the significance of transcription and translation in overall physiology of Human or bacterial cells? 2. What is transcription? 3. What is translation? 4. What are the differences between Transcription and replication 5. What're the differences between the Transcription and Translation process in human cells versus bacterial cells? 6. What are the functions of RNA polymeraseI, Il and 1lI? 7. What is a promoter and what are the important sequences within a promoter? 8. What is the role...
1. The figure above represents A. replication B. transformation C. transcription D. translation
4. When & where does replication occur? 5. What is the point of transcription? Where does it occur? 6. What are three nucleotides together called on mRNA? (ie: ACA) 7. The mRNA codons can be used in a chart to find: 8. What molecule contains an anti-codon? During what process is it used? 10. Translation takes place in a 11. and _make up ribosomes. 12. What is the point of translation? 13. Transcription and translation together is the process of
BI U A. A. EEE 1. What is replication? 2. What is Transcription? 3. What are the differences between replication and transcription? 4. What is translation? 5. What is the role of mRNA, TRNA, and tRNA during translation? 6. What is the function of ribosomes? 7. Which enzyme catalyzes the transcription? 8. A DNA molecule has two strands (double helix) - how many of its strands are/is replication and transcription? 9. What is the difference between transcription and translation occurring...
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...
Define termsDNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication, mutation, gene, amino acid, polypeptide chain, protein, codon, promoter region of a gene, RNA polymerase, transcription, mRNA, tRNA, RNA, ribosomes, translation, gene expression, conjugation, conjugative pilus, transformation, transductionExplain concept or process• Describe how nucleotides are linked together to form a single strand of nucleic acid• Explain the concept of a complementary pairing • Describe how DNA replication occurs in bacteria • Explain why a primer is necessary for...
Indicate which cellular processes directly require DNA replication (R), transcription (TC), or translation (TL). 'Directly' means the cellular process that must occur immediately before the one in the question. synthesis and secretion of insulin from the liver meiosis of spermatogonia production of LH mRNA in the pituitary gland mitosis of intestinal epithelial cells synthesis of steroid hormone receptors
Uluruunu us RJ15 1. Draw or describe the process of eukaryotic transcription and translation, using the following terms as needed (not all terms will be used): sigma factor, RNA polymerase, DNA polymerase, origin of replication, ribosome, start codon, transcriptional start site, stop codon, nucleus, -10 and -35 sequences, TATA box, TBP, inducer, transcriptional stop site, Shine-Delgrano sequence, Kozak sequence, RNA splicing. 2. Draw or describe the process of prokaryotic/eubacterial transcription and translation, using as many of the terms above as...
1. Which of the following statements concerning transcription of bacterial mRNA is not true? Bacterial mRNA must have intron material removed before it can be used in the process of protein translation.* Energy necessary for transcription is provided by the breaking of phosphate bonds carried by ribonucleotide triphosphates (rNTPs). A sigma factor recognizes the promoter site sequences on the DNA strand during transcription. A guanine-rich sequence on the template DNA molecule causes the growing RNA strand to loop and detach.