Homework Answers
l
Add Answer to:
4. When & where does replication occur? 5. What is the point of transcription? Where does it occur? 6. What are...
10. With regard to transcription, the enzyme begins of a DNA transcribing RNA after it attaches...
10. With regard to transcription, the enzyme begins of a DNA transcribing RNA after it attaches to the molecule. With regard to translation, the begins translating a polypeptide after it attaches to the __ of an mRNA molecule. Start and stop codons are involved in the process of The start codon is , while the stop codons are 11. and Does the start codon specify an amino acid? If so, which one(s)? Do the stop codons specify an amino acid?...
BI U A. A. EEE 1. What is replication? 2. What is Transcription? 3. What are...
BI U A. A. EEE 1. What is replication? 2. What is Transcription? 3. What are the differences between replication and transcription? 4. What is translation? 5. What is the role of mRNA, TRNA, and tRNA during translation? 6. What is the function of ribosomes? 7. Which enzyme catalyzes the transcription? 8. A DNA molecule has two strands (double helix) - how many of its strands are/is replication and transcription? 9. What is the difference between transcription and translation occurring...
What are the three functional groups that comprise a nucleotide? What do nucleotides have in common...
What are the three functional groups that comprise a nucleotide? What do nucleotides have in common with amino acids or simple sugars? When the structure of DNA was first elucidated, many biologists quickly saw how this structure explained the passage of information from one generation to another. How does the structure of DNA explain generation-to-generation flow of information? In other words, give a brief description of the structure of DNA and tell how this structure allows for replication. Which of...
DNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication
Define termsDNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication, mutation, gene, amino acid, polypeptide chain, protein, codon, promoter region of a gene, RNA polymerase, transcription, mRNA, tRNA, RNA, ribosomes, translation, gene expression, conjugation, conjugative pilus, transformation, transductionExplain concept or process• Describe how nucleotides are linked together to form a single strand of nucleic acid• Explain the concept of a complementary pairing • Describe how DNA replication occurs in bacteria • Explain why a primer is necessary for...
where does transcription begin 3. List the major types of RNA and include what they code...
where does transcription begin
3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...
Question 9: The genetic code is read in groups of three nucleotides, called codons, in mRNA...
Question 9:
The genetic code is read in groups of three nucleotides, called
codons, in mRNA that specifies for a particular amino acid.
tRNA molecules act as the amino acid carriers that by correctly
pairing with the codon on mRNA can deliver the correct amino acid
to the ribosome during translation. At the tip of each tRNA
molecule is a group of three nucleotides called an anticodon and at
the other end is where the corresponding amino acid is attached...
1. Transcription occurs in the a. Nucleus. b. Ribosomes of the Rough Endoplasmic Reticulum. c. Mitochondrion....
1. Transcription occurs in the a. Nucleus. b. Ribosomes of the Rough Endoplasmic Reticulum. c. Mitochondrion. d. Cell membrane. e. Smooth Endoplasmic Reticulum. 2. The monomers of DNA and RNA are a. amino acids. b. monosaccharides. c. nucleotides. d. fatty acids. e. nucleic acids. 3. Which of the following statements regarding DNA is false? a. DNA uses the nitrogenous base uracil. b. DNA is a nucleic acid. c. One DNA molecule can include four different nucleotides in its structure. d....
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
Complete a concept map of translation, indicate where it takes place, and describe what will happen...
Complete a concept map of translation, indicate where it takes place, and describe what will happen if the anticodon is not attached to transfer RNA. A)DNA unzips ?transcription of mRNA ? mRNA leaves nucleus ? mRNA binds to ?ribosome ? tRNA brings in amino acid? tRNA anticodon binds to codon on mRNA ? peptide bond binds amino acids to form protein ? transport of the amino acids to the mRNA by tRNA continues until the mRNA translation is completed. This...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...
10. With regard to transcription, the enzyme begins of a DNA transcribing RNA after it attaches to the molecule. With regard to translation, the begins translating a polypeptide after it attaches to the __ of an mRNA molecule. Start and stop codons are involved in the process of The start codon is , while the stop codons are 11. and Does the start codon specify an amino acid? If so, which one(s)? Do the stop codons specify an amino acid?...
BI U A. A. EEE 1. What is replication? 2. What is Transcription? 3. What are the differences between replication and transcription? 4. What is translation? 5. What is the role of mRNA, TRNA, and tRNA during translation? 6. What is the function of ribosomes? 7. Which enzyme catalyzes the transcription? 8. A DNA molecule has two strands (double helix) - how many of its strands are/is replication and transcription? 9. What is the difference between transcription and translation occurring...
where does transcription begin
3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...
Question 9:
The genetic code is read in groups of three nucleotides, called
codons, in mRNA that specifies for a particular amino acid.
tRNA molecules act as the amino acid carriers that by correctly
pairing with the codon on mRNA can deliver the correct amino acid
to the ribosome during translation. At the tip of each tRNA
molecule is a group of three nucleotides called an anticodon and at
the other end is where the corresponding amino acid is attached...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...
Most questions answered within 3 hours.
-
Ripples in a pond travel at a velocity of 3 m/s with one peak
passing a...
asked 5 minutes ago -
A man stands on the roof of a building of height 13.0 mm and
throws a...
asked 11 minutes ago -
Based on the range, which of the following sets of scores has
the greatest variability? 3,...
asked 14 minutes ago -
The extent to which assets are financed by borrowed funds and
other liabilities is indicated by:...
asked 1 hour ago -
Explain in detail
Germany is the fifth largest economy
explain what goods and services Germany specializes...
asked 1 hour ago -
The density of platinum is 21.45 g/mL. If a cube of platinum
with a mass of...
asked 1 hour ago -
Accounts Receivable
Sales
A/R Posting
Extended Sales Invoice
Packing Slip
Compare invoice to packing slip 2...
asked 1 hour ago -
Michaella, age 23, is a full-time law student and is claimed by
her parents as a...
asked 1 hour ago -
Why are polymers not typically casted into products?
asked 1 hour ago -
When rolling a die 129 times, what is the probability of rolling
a 6 no more...
asked 2 hours ago -
4. A call option currently sells for $7.75. It has a strike
price of $85 and...
asked 1 hour ago -
1.
You need to prepare 10.0 liters of an acid aqueous solution with a
pH of...
asked 2 hours ago