Because there is change from ala to thr in the human protein,the sequence of the non-template strand must have been altered from a G in the first position to a A in the first position. The base pair change must have been a GC base pair to AC base pair in the DNA coding for first position of the codon.
This is the cases of mis-sense mutation in which single amino acid change is found.
A small portion of the human transport protein amino acid sequence is shown below. The upper...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291–300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-Tyr-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291-300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-In-Ala-Leu-Leu-Tyr-Lys-Phe...Ile-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
you are informed that CGATCA codes for an intron UUU)phe UCU UAU TVE UUC) Pne UCC Ser UAC 'yr UUA UCA Ser UUG Leu UCG) UGUve UGC Cys UAA Stop UGA Stop UAG Stop UGG Trp CGU) CGC CCU CUU CUC CCC Pro CAC His CỦA Leu CCA CCG) CAAGI CGA Arg CUG) CAGS CGG First letter DOC DOC DOC Doco Third letter AAU Asn AGU Ser AGC Se AAA Lys AGA Arg AAG AGG/Arg AUU ACU AUC lle ACC...
Bring this DNA sequence to protein using the transcription (3pts) and translation (4 pts) processes. note: Pending the direction your DNA is located Second position UUU Ae UCU UCC cys DU Sey UAU UAC UAA UAG UGU UGC UGA UGG UUA tyr Stop Stop JC Stop CUU CUC his CUA 5 'ATGCCGACGCCATAA 3' Lleve esta secuencia de ADN hasta proteína mediante los procesos de transcripción (3pts) y traducción (4 pts). First position (5'-end) CUC AUU AUC ile AUA AUG met...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...