The genetic code is not overlapping. That means adjacent codons do not share nucleotides. Hence statement, genetic code is overlapping is the wrong statement.
Cytosine and guinine have three hydrogen bonds in contrast to adenine and thymine which have two hydrogen bonds. Hence GC pair is stronger compared to AT pair. Hence correct option is three hydrogen bonds.
The amino acid sequence in a polypeptide is known as primary structure of the protein. Hence correct option is primary structure.
One gene can have multiple effects is true statement. This effect is known as pleiotrophy. This effect is seen when there is a mutation in a single gene which affects multiple traits.
Note: As per Chegg guidelines we are supposed to answer first four questions. Hence please re-post rest questions in a set of four questions. We would be happy to help you. Thank you.
2 points Which of the statements below is false? * O The genetic code is universal....
1.All cells in a human body undergo the process of meiosis. True False 2. Most cells in the human body contain 46 chromosomes. True False 3. The chances that any two siblings will be genetically identical is astronomically small. True False 4. Each time protein synthesis occurs; all of the DNA of a cell is copied. True False RNA creation occurs in the nucleus of a cell; protein synthesis occurs on the ribosomes. True False 6. Tay-Sachs syndrome is a...
can u tell me if these answers are correct please!??!!! Choose the best answer for the following questions. Place your answer on the line. If your answer is not on the line.it does not count 1 Mender's discovery that characteristics are inherited due to the transmission of hereditary factors resulted from his (1) dissections to determine how fertilization occurs in pea plants (2analysis of the offspring produced from many pea plant crosses (3) careful microscopic examinations of genes and chromosomes...
24. What would be the anticodon if the template strand of DNA Is ACC A UCC B.) TGG UGG D. ACC E. TCC 25. Prior to protein synthesis, the DNA A. attracts tRNAs with appropriate amino acids. 6.) serves as a template for the production of mRNA. C. adheres to ribosomes for protein synthesis. D. contains anticodons that become codons. E. must first undergo replication. 26. The Human Genome Project has revealed that human DNA has approximately A. 30,000 bases...
21-1114 Date Transcription Kit Checklist Part 1: Making mRNA 1. Parts of a nucleotide: Approved Sugar Phosphate Bases: Adenine Guanine Cytosine Uracil 2. One nucleotide Note: Omit 3-6 if not using the DNA Structure and Function Kit. 3. Separated DNA 4. Template DNA with one complementary nucleotide of RNA hydrogen bonded 5. Template DNA with strand of mRNA hydrogen bonded 6. Separated mRNA and duplex DNA molecule 7. Completed mRNA with cap and tail 8. The cap 9. The tail...
Hello, I just need someone to check my answer: The answer I choose are in bold points. 1. What was the most significant conclusion that Gregor Mendel drew from his experiments with pea plants? Recessive genes occur more frequently in the F1 generation than do dominant ones Traits are inherited in discrete units, and are not the results of "blending" There is considerable genetic variation in garden peas Genes are composed of DNA 2. In a particular plant, two genes...
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...
QUESTION5 2 points Saver There are two oategories of biologie theories of aging random aging and programmed aging Match the theory below with ts appropriate category Cross-Iinking of DNA and protein A Random aging Free radical damage Programmed aging Telomere shortening Decline in immune function Wear and tea Limited number of cell divisions Biological clock Accumulation of arors QUESTION 6 as points Save Ans Normal cels grown in the laboratory do not age, but divide indefinitely True False QUESTION 7...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
U m Olle Honor code. true O False Question 2 (5 points) Saved Name 4 factors other than initial cost that you might consider when buying a car. Annual Operating and maintenance cost Salvage value Saved