Homework Answers
Add Answer to:
2. The 2019 nCoV virus (Wuhan Coronavirus) has 28000 base pairs. How many average sized proteins...
1) What is the genetic material in Coronavirus (also known as 2019-nCov or COVID-19)? How many...
1) What is the genetic material in Coronavirus (also known as 2019-nCov or COVID-19)? How many nucleotides does the genome of this virus contain? Based on what we discussed in the lecture, which CRISPR/Cas system do you think has the potential to degrade the Coronavirus genome in infected humans to treat the disease? (Hint: read the required reading on Coronavirus sequence and refer to lectures to answer these questions).
How has the genetic composition of the novel 2019 coronavirus or covid virus evolved as it...
How has the genetic composition of the novel 2019 coronavirus or covid virus evolved as it has spread globally?
Find the forward and reverse primer at 68 degrees C. How many base pairs will the...
Find the forward and reverse primer at 68 degrees C. How many base pairs will the PCR product be that is generated by using these primers? How many amino acids is the predicted protein encoded by this open reading frame? Here's the complete genome of SARS coronavirus >Genome ATGTTTATTTTCTTATTATTTCTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATGATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTTTACTATCCTGATGAAATTTTTAGATCAGACACTCTTTATTTAACTCAGGATTTATTTCTTCCATTTTATTCTAATGTTACAGGGTTTCATACTATTAATCATACGTTTGGCAACCCTGTCATACCTTTTAAGGATGGTATTTATTTTGCTGCCACAGAGAAATCAAATGTTGTCCGTGGTTGGGTTTTTGGTTCTACCATGAACAACAAGTCACAGTCGGTGATTATTATTAACAATTCTACTAATGTTGTTATACGAGCATGTAACTTTGAATTGTGTGACAACCCTTTCTTTGCTGTTTCTAAACCCATGGGTACACAGACACATACTATGATATTCGATAATGCATTTAATTGCACTTTCGAGTACATATCTGATGCCTTTTCGCTTGATGTTTCAGAAAAGTCAGGTAATTTTAAACACTTACGAGAGTTTGTGTTTAAAAATAAAGATGGGTTTCTCTATGTTTATAAGGGCTATCAACCTATAGATGTAGTTCGTGATCTACCTTCTGGTTTTAACACTTTGAAACCTATTTTTAAGTTGCCTCTTGGTATTAACATTACAAATTTTAGAGCCATTCTTACAGCCTTTTCACCTGCTCAAGACATTTGGGGCACGTCAGCTGCAGCCTATTTTGTTGGCTATTTAAAGCCAACTACATTTATGCTCAAGTATGATGAAAATGGTACAATCACAGATGCTGTTGATTGTTCTCAAAATCCACTTGCTGAACTCAAATGCTCTGTTAAGAGCTTTGAGATTGACAAAGGAATTTACCAGACCTCTAATTTCAGGGTTGTTCCCTCAGGAGATGTTGTGAGATTCCCTAATATTACAAACTTGTGTCCTTTTGGAGAGGTTTTTAATGCTACTAAATTCCCTTCTGTCTATGCATGGGAGAGAAAAAAAATTTCTAATTGTGTTGCTGATTACTCTGTGCTCTACAACTCAACATTTTTTTCAACCTTTAAGTGCTATGGCGTTTCTGCCACTAAGTTGAATGATCTTTGCTTCTCCAATGTCTATGCAGATTCTTTTGTAGTCAAGGGAGATGATGTAAGACAAATAGCGCCAGGACAAACTGGTGTTATTGCTGATTATAATTATAAATTGCCAGATGATTTCATGGGTTGTGTCCTTGCTTGGAATACTAGGAACATTGATGCTACTTCAACTGGTAATTATAATTATAAATATAGGTATCTTAGACATGGCAAGCTTAGGCCCTTTGAGAGAGACATATCTAATGTGCCTTTCTCCCCTGATGGCAAACCTTGCACCCCACCTGCTCTTAATTGTTATTGGCCATTAAATGATTATGGTTTTTACACCACTACTGGCATTGGCTACCAACCTTACAGAGTTGTAGTACTTTCTTTTGAACTTTTAAATGCACCGGCCACGGTTTGTGGACCAAAATTATCCACTGACCTTATTAAGAACCAGTGTGTCAATTTTAATTTTAATGGACTCACTGGTACTGGTGTGTTAACTCCTTCTTCAAAGAGATTTCAACCATTTCAACAATTTGGCCGTGATGTTTCTGATTTCACTGATTCCGTTCGAGATCCTAAAACATCTGAAATATTAGACATTTCACCTTGCGCTTTTGGGGGTGTAAGTGTAATTACACCTGGAACAAATGCTTCATCTGAAGTTGCTGTTCTATATCAAGATGTTAACTGCACTGATGTTTCTACAGCAATTCATGCAGATCAACTCACACCAGCTTGGCGCATATATTCTACTGGAAACAATGTATTCCAGACTCAAGCAGGCTGTCTTATAGGAGCTGAGCATGTCGACACTTCTTATGAGTGCGACATTCCTATTGGAGCTGGCATTTGTGCTAGTTACCATACAGTTTCTTTATTACGTAGTACTAGCCAAAAATCTATTGTGGCTTATACTATGTCTTTAGGTGCTGATAGTTCAATTGCTTACTCTAATAACACCATTGCTATACCTACTAACTTTTCAATTAGCATTACTACAGAAGTAATGCCTGTTTCTATGGCTAAAACCTCCGTAGATTGTAATATGTACATCTGCGGAGATTCTACTGAATGTGCTAATTTGCTTCTCCAATATGGTAGCTTTTGCACACAACTAAATCGTGCACTCTCAGGTATTGCTGCTGAACAGGATCGCAACACACGTGAAGTGTTCGCTCAAGTCAAACAAATGTACAAAACCCCAACTTTGAAATATTTTGGTGGTTTTAATTTTTCACAAATATTACCTGACCCTCTAAAGCCAACTAAGAGGTCTTTTATTGAGGACTTGCTCTTTAATAAGGTGACACTCGCTGATGCTGGCTTCATGAAGCAATATGGCGAATGCCTAGGTGATATTAATGCTAGAGATCTCATTTGTGCGCAGAAGTTCAATGGACTTACAGTGTTGCCACCTCTGCTCACTGATGATATGATTGCTGCCTACACTGCTGCTCTAGTTAGTGGTACTGCCACTGCTGGATGGACATTTGGTGCTGGCGCTGCTCTTCAAATACCTTTTGCTATGCAAATGGCATATAGGTTCAATGGCATTGGAGTTACCCAAAATGTTCTCTATGAGAACCAAAAACAAATCGCCAACCAATTTAACAAGGCGATTAGTCAAATTCAAGAATCACTTACAACAACATCAACTGCATTGGGCAAGCTGCAAGACGTTGTTAACCAGAATGCTCAAGCATTAAACACACTTGTTAAACAACTTAGCTCTAATTTTGGTGCAATTTCAAGTGTGCTAAATGATATCCTTTCGCGACTTGATAAAGTCGAGGCGGAGGTACAAATTGACAGGTTAATTACAGGCAGACTTCAAAGCCTTCAAACCTATGTAACACAACAACTAATCAGGGCTGCTGAAATCAGGGCTTCTGCTAATCTTGCTGCTACTAAAATGTCTGAGTGTGTTCTTGGACAATCAAAAAGAGTTGACTTTTGTGGAAAGGGCTACCACCTTATGTCCTTCCCACAAGCAGCCCCGCATGGTGTTGTCTTCCTACATGTCACGTATGTGCCATCCCAGGAGAGGAACTTCACCACAGCGCCAGCAATTTGTCATGAAGGCAAAGCATACTTCCCTCGTGAAGGTGTTTTTGTGTTTAATGGCACTTCTTGGTTTATTACACAGAGGAACTTCTTTTCTCCACAAATAATTACTACAGACAATACATTTGTCTCAGGAAATTGTGATGTCGTTATTGGCATCATTAACAACACAGTTTATGATCCTCTGCAACCTGAGCTTGACTCATTCAAAGAAGAGCTGGACAAGTACTTCAAAAATCATACATCACCAGATGTTGATCTTGGCGACATTTCAGGCATTAACGCTTCTGTCGTCAACATTCAAAAAGAAATTGACCGCCTCAATGAGGTCGCTAAAAATTTAAATGAATCACTCATTGACCTTCAAGAATTGGGAAAATATGAGCAATATATTAAATGGCCTTGGTATGTTTGGCTCGGCTTCATTGCTGGACTAATTGCCATCGTCATGGTTACAATCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAAGTTTGATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA
If DNA has 3,400,000 base pairs, how many turns does it have?
If DNA has 3,400,000 base pairs, how many turns does it have?
Gene X is 3000 base pairs in length. How many CODONS make up this GeneX? (1...
Gene X is 3000 base pairs in length. How many CODONS make up this GeneX? (1 pt) How many amino acids would be in the protein coded for by Gene X? (1 pt) The protein coded for by Gene Y is 100 amino acids in length. How many base pairs are in Gene Y2 (1 pt) How many codons would be in Gene Y? (1 pt) Gene Z is 360 base pairs in length. How many amino acids are in...
9. A DNA molecule has 180 base pairs and is 20 percent adenine. How many cytosine...
9. A DNA molecule has 180 base pairs and is 20 percent adenine. How many cytosine nucleotides are present in this molecule of DNA?
A 100 base pair double strand is 20% A (remember base pairs) 1. How many bases...
A 100 base pair double strand is 20% A (remember base pairs) 1. How many bases ( in number) are T? 2. What percentage of bases are C? 3. How many hydrogen bonds hold the strands together?
a prokaryotic cell having 200,000 base pairs, how many atoms of phosphorous would it have? thank...
a prokaryotic cell having 200,000 base pairs, how many atoms of phosphorous would it have? thank you.
the drosophila chromosome #3 is 27.9 million base pairs long. 1. how many nucleosomes and histones...
the drosophila chromosome #3 is 27.9 million base pairs long. 1. how many nucleosomes and histones would be present on one of these chromosomes at the mitotic metaphase plate? 2. if this chromosome is 30% G/C, how many hydrogen bonds and phosphodiester linkages would a single chromosome have before the S phase? 3. how many of these G0 chromosomes would you need to stretch end to end to equal one kilometer?
1. Daphne has 4 pants, 3 pairs of shoes & 5 Tops. In how many ways...
1. Daphne has 4 pants, 3 pairs of shoes & 5 Tops. In how many ways can she create an outfit ? 2. A four digit code is to be created using 2, a, b, 3, 4, c, d, 5 A. In how many ways can the code be created if the last digit is a number and the digits can repeat B. In how many ways can the code be created if the digits must alternate with numbers and...
1) What is the genetic material in Coronavirus (also known as 2019-nCov or COVID-19)? How many nucleotides does the genome of this virus contain? Based on what we discussed in the lecture, which CRISPR/Cas system do you think has the potential to degrade the Coronavirus genome in infected humans to treat the disease? (Hint: read the required reading on Coronavirus sequence and refer to lectures to answer these questions).
Gene X is 3000 base pairs in length. How many CODONS make up this GeneX? (1 pt) How many amino acids would be in the protein coded for by Gene X? (1 pt) The protein coded for by Gene Y is 100 amino acids in length. How many base pairs are in Gene Y2 (1 pt) How many codons would be in Gene Y? (1 pt) Gene Z is 360 base pairs in length. How many amino acids are in...
9. A DNA molecule has 180 base pairs and is 20 percent adenine. How many cytosine nucleotides are present in this molecule of DNA?
A 100 base pair double strand is 20% A (remember base pairs) 1. How many bases ( in number) are T? 2. What percentage of bases are C? 3. How many hydrogen bonds hold the strands together?
Most questions answered within 3 hours.
-
Wildhorse Company follows the practice of pricing its inventory
at the lower-of-cost-or-market, on an individual-item
basis....
asked 28 minutes ago -
3. (10 pts) You grow a corn crop that yields 150 bushels ac-1,
with the following...
asked 17 minutes ago -
7. The term Six Sigma refers to:
Select one:
a. The control limits established in a...
asked 26 minutes ago -
For the following reaction: A(g) + 2 B(g) ⇌ 2 C(g) Calculate the
equilibrium constant K...
asked 29 minutes ago -
Which of the following best describes tidal volume? options:
1.The amount of oxygen in the air...
asked 45 minutes ago -
1. Smaller cost distortions occur when the traditional systems'
single indirect-cost rate and the activity-cost-driver rates:...
asked 53 minutes ago -
Using either a FMECA approach or some other appropriate RCA
tool, identify five risk treatment actions...
asked 53 minutes ago -
If for a test the P-value is between 0.0025 and 0.005, what
conclusion can you draw?...
asked 1 hour ago -
Using Python. Write a function clean2(aList) that takes a list
of integers aList as argument, and...
asked 1 hour ago -
Intrapreneurship is defined as the
development of an enterprise culture with an existing (Nandan,
2009). An...
asked 1 hour ago -
QUESTION 1 Tamiflu is a drug used to treat influenza. A study
found that Tamiflu reduced...
asked 1 hour ago -
Which of the following would be less likely to be used to
allocate factory overhead when...
asked 1 hour ago