Answer 1
Number of bases = 5
Minimum codon length needed to code for four amino acids = 5^1= 5 different combinations are possible
Here 1 base = 1 codon
Minimum codon length needed to code for 20 amino acids = 5^2 = 25 different combinations are possible
Here 2 bases = 1 codon
Minimum codon length needed to code for amino acids = 5^3= 125 different combinations are possible
Here 3 bases = 1 codon
Answer 2
The minimum codon length for 4 amino acid is 4*4 =16 base pairs
Minimum codon length required to code 4 amino acids ie. the total bases required would be = 4X 4= 16 bases / 4 genetic codons.
JURCU U U This tutorial will take you step-by-step through the question. If there are five...
1. Five different bases and codon length of one results in a maximum of 5 codons, and five different bases and codon length of two results in a maximum of 25 codons. Which mathematical formula represents the relationship between the number of bases, codon length, and number of codons possible? (number of bases = n codon length = L) number of codons: ___________ 2. Calculate the minimum codon length needed to define four amino acids. With five bases, what is...
If there are five different types of bases in mRNA instead of four, what would be the minimum codon length needed to specify for four, twenty, and thirty different codons, or amino acids? Four codons: Number basels) Twenty codons: Number basefs) Thirty codons: Number basels) @Previous O Check Answer @Next嘓Exit Hint
Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of tRNAs. If the mRNA sequence is translated into a fourteen amino acid peptide (starting at first 5 nucleotide), which of the following statements are true? Refer to the Codon Table and the table of "wobble rules" in the Hint. Gly, Glu, and Ser are repeated in the sequence and each uses multiple codons. Wobble rules allow Glu and Ser to use one tRNA each...
22. The wobble rules for tRNA-mRNA pairing are shown in Figure 15.12b. If we assume that the tRNAS do not contain modified bases, what is the minimum number of tRNAs needed to efficiently recognize the codons for the following types of amino acids? a. Leucine b. Methionine c. Serine Phenylalanine Third base of mRNA codon AAG ... Base in anticodon can be U, 1, xm sau. xm Um, Um, xmu.xou, k2C A, G, U. 1, xoSu C, A, U, XOSU...
C++: Translating mRNA sequence help
Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide...
The genetic code is "redundant" because: Question 1 options: Each amino acid is specified by only a single codon Most amino acids are specified by multiple codons Codons are groups of four consecutive DNA bases Each codon can specify multiple amino acids Question 2 (1 point) A mutation in the DNA may not result in change in protein function because: Question 2 options: Many different amino acids share similar chemical properties, so can substitute for one another without altering function...
The genetic code is "redundant" because: Question 1 options: Each amino acid is specified by only a single codon Most amino acids are specified by multiple codons Codons are groups of four consecutive DNA bases Each codon can specify multiple amino acids Question 2 (1 point) A mutation in the DNA may not result in change in protein function because: Question 2 options: Many different amino acids share similar chemical properties, so can substitute for one another without altering function...
mestion 2 of 15 > Consider the sequencing chromatograms of the four variants of the alpha chain of human hemoglobin. Normal Karachi Chongqing Swan River ddATP ddCTP ATD about us Careers privacy policy terms of use contact us help ddATP ddCTP ddGTP ddTTP You can use the codon table to decode each amino acid sequence. For example, the first triplet in each sequencing chromatogram is GTG, which encodes for Val. What is the nature of the amino acid change in...
21. One form of thalassemia has a single G->A mutation in the B-globin gene at the first nucleotide in the intron. This destroys the S' splice junction. The mRNA remains unspliced, leaving nucleotide intron in place. Assuming no stop codons are introduced in the intron pro second exon would be in-frame or out of frame in the translated protein dict if the A. In frame B. Out of frame Phe Ser Ty Cys U Phe Ser Cys Leu Se Stop...
What are the three functional groups that comprise a nucleotide? What do nucleotides have in common with amino acids or simple sugars? When the structure of DNA was first elucidated, many biologists quickly saw how this structure explained the passage of information from one generation to another. How does the structure of DNA explain generation-to-generation flow of information? In other words, give a brief description of the structure of DNA and tell how this structure allows for replication. Which of...