Number of bases = 5
Minimum codon length required to specify four amino acids =
51 = 5 different combinations
1 base = 1 codon
Minimum codon length required to specify 20 amino acids =
52 = 25 different combinations
2 bases = 1 codon
Minimum codon length required to specify four amino acids =
53 = 125 different combinations
3 bases = 1 codon
If there are five different types of bases in mRNA instead of four, what would be...
1. Five different bases and codon length of one results in a maximum of 5 codons, and five different bases and codon length of two results in a maximum of 25 codons. Which mathematical formula represents the relationship between the number of bases, codon length, and number of codons possible? (number of bases = n codon length = L) number of codons: ___________ 2. Calculate the minimum codon length needed to define four amino acids. With five bases, what is...
JURCU U U This tutorial will take you step-by-step through the question. If there are five different types of bases in mRNA instead of four, what will be the minimum codon length needed to specify for 4, 20, and 30 different codons, or amino acids? Step 5: Calculate the minimum codon length needed to define four amino acids. With five bases, what is the minimum codon length needed to specify four codons? minimum codon length: base(s) Question Source: Pierce 6e...
Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of tRNAs. If the mRNA sequence is translated into a fourteen amino acid peptide (starting at first 5 nucleotide), which of the following statements are true? Refer to the Codon Table and the table of "wobble rules" in the Hint. Gly, Glu, and Ser are repeated in the sequence and each uses multiple codons. Wobble rules allow Glu and Ser to use one tRNA each...
What is the minumum number of tRNA molecules that a cell must
contain in order to translate all 61 sense codons?
Match the words in the left column to the appropriate blanks in
the sentences on the right.
second tRNAs with variations each in the positions would sixty one tRNAs suffice to translate sixteen amino acids. Because of wobble in the position, only variations suffice to translate all twenty amino acids. Therefore, sixteen should be the minimum needed to translate...
What is the minumum number of tRNA molecules that a cell must
contain in order to translate all 61 sense codons?
Match the words in the left column to the appropriate blanks in
the sentences on the right.
three tRNAs with variations each in the positions would thirty two tRNAs suffice to translate sixteen amino acids. Because of wobble in the position, only variations suffice to translate all twenty amino acids. Therefore, sixty one tRNAS should be the minimum needed...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
A protein composed of fifty amino-acids would require a minimum of _ nucleotides in the mRNA to represent all of the codons needed to correctly translate the protein. 50 O 100 147 150 153
please help !
What would be the mRNA strand if the DNA strand reads: TACCGAGTCACG? Check Answer Use the codon table to answer the following questions: THE CODON TABLE SECOND POSITION FIRST POSITION THIRD POSITION 0000000000000000 What would be the second amino acid produced by the DNA strand TACCGA GTCACG (Hint: use the mRNA strand you already coded) Check Answer Value: 1 What would be the third amino acid produced by the DNA strand: TACCGAGTCACG (Hint: use the mRNA strand...
22. The wobble rules for tRNA-mRNA pairing are shown in Figure 15.12b. If we assume that the tRNAS do not contain modified bases, what is the minimum number of tRNAs needed to efficiently recognize the codons for the following types of amino acids? a. Leucine b. Methionine c. Serine Phenylalanine Third base of mRNA codon AAG ... Base in anticodon can be U, 1, xm sau. xm Um, Um, xmu.xou, k2C A, G, U. 1, xoSu C, A, U, XOSU...
C++: Translating mRNA sequence help
Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide...