We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
A protein composed of fifty amino-acids would require a minimum of _ nucleotides in the mRNA...
Question 8 2.5 pts If a protein (polypeptide) is composed of 210 amino acids, how many mRNA codons would be required? Question 9 2.5 pts If a protein (polypeptide) is composed of 210 amino acids, how many mRNA ribonucleotides would be required?
How do nucleotides of mRNA chains encode information for the formation of the amino acids sequences of a protein?
What is the minimum number of nucleotides needed to code for 100 amino acids?
Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of tRNAs. If the mRNA sequence is translated into a fourteen amino acid peptide (starting at first 5 nucleotide), which of the following statements are true? Refer to the Codon Table and the table of "wobble rules" in the Hint. Gly, Glu, and Ser are repeated in the sequence and each uses multiple codons. Wobble rules allow Glu and Ser to use one tRNA each...
You are studying an interesting protein in nematode worms that is 100 amino acids in length. Of particular interest is the fact that the last seven amino acids are all tryptophan (codons 94 through 100). Draw here the mRNA sequence for codons 94-100: Draw here the sequence of the DNA strand RNA polymerase used as its template (show 5' 3' polarity): You mutagenize the wild type worm. Assume for the next questions you are able to isolate both normal and...
A protein has a sequence of 100amino acids, how many nucleotides does the mRNA strand that encodes it have? (choose the best answer) a.400 b.100 c.200 d.300
QUESTION 29 How long would a mRNA coding for a protein with 106 amino acids be if it had 5' and 3' UTRs of 30 bases each? (Assume stop codon is part of the last exon)
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
If there are five different types of bases in mRNA instead of four, what would be the minimum codon length needed to specify for four, twenty, and thirty different codons, or amino acids? Four codons: Number basels) Twenty codons: Number basefs) Thirty codons: Number basels) @Previous O Check Answer @Next嘓Exit Hint
aus: 99 Consider the following DNA sequence: TTAGATCGTAAAGTGCAATGGGATCATATG What would be the mRNA transcribed from this DNA sequence? ots)? 10 AAU CUA G CA unU CAC Gui ACC CUA GUAU- How many codons does the sequence contain 21 th A How many amino acids make up this protein? (1 pt) List the amino acids, in order, that make up this protein using the chart provided. (5 pts) Referring to the mRNA strand constructed in Question #3, list the tRNA anti-codons...