A protein has a sequence of 100amino acids, how many nucleotides does the mRNA strand that...
Homework Answers
Ans: d. 300
A protein has a sequence of 100 amino acids. We know that each codon can encode one amino acid and each codon has three nucleotides (example: AGU). Thus to have one amino acid three nucleotides are needed.
Therefore to make a protein sequence of 100 amino acids ( 100 x 3 )= 300 nucleotides are required.
Add Answer to:
A
protein has a sequence of 100amino acids, how many nucleotides does
the mRNA strand that...
Imagine protein X is a protein that is secreted out of the cell. How does the...
Imagine protein X is a protein that is secreted out of the cell. How does the cell "know" that protein X needs to be synthesized at the endoplasmic reticulum (ER)? A.The DNA that codes for protein X has a sequence of nucleotides that bind to a special protein/RNA complex B. The ribosome that translates protein X has a sequence of nucleotides that bind to a special protein/RNA complex C. Protein X has a sequence of amino acids that bind to...
A protein composed of fifty amino-acids would require a minimum of _ nucleotides in the mRNA...
A protein composed of fifty amino-acids would require a minimum of _ nucleotides in the mRNA to represent all of the codons needed to correctly translate the protein. 50 O 100 147 150 153
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
What role does mRNA play in the process of protein synthesis? Choose all that apply. Select...
What role does mRNA play in the process of protein synthesis? Choose all that apply. Select one or more: Every three nucleotides binds an amino acid It opens up the DNA strand for transcription to occur ] c. It is a template for the arrangement of tRNAS 1 d. It determines the order in which amino acids are added to the growing protein e. It copies DNA to be used in later steps
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of...
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of the DNA template strand from which it was transcribed? 2) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?
How do nucleotides of mRNA chains encode information for the formation of the amino acids sequences...
How do nucleotides of mRNA chains encode information for the formation of the amino acids sequences of a protein?
aus: 99 Consider the following DNA sequence: TTAGATCGTAAAGTGCAATGGGATCATATG What would be the mRNA transcribed from this...
aus: 99 Consider the following DNA sequence: TTAGATCGTAAAGTGCAATGGGATCATATG What would be the mRNA transcribed from this DNA sequence? ots)? 10 AAU CUA G CA unU CAC Gui ACC CUA GUAU- How many codons does the sequence contain 21 th A How many amino acids make up this protein? (1 pt) List the amino acids, in order, that make up this protein using the chart provided. (5 pts) Referring to the mRNA strand constructed in Question #3, list the tRNA anti-codons...
If a protein has 200 amino acids, and the gene that codes for it has 50...
If a protein has 200 amino acids, and the gene that codes for it has 50 percent intron nucleotides, the number of nucleotides in the gene will be approximately: Select one: a. 200 b. 400 c. 600 d. 1200 e. 1000
A protein consists of 300 amino acids. How many bases will be necessary in the processed...
A protein consists of 300 amino acids. How many bases will be necessary in the processed mRNA, to code for this protein? Assume introns have been extracted from the processed mRNA.
A protein composed of fifty amino-acids would require a minimum of _ nucleotides in the mRNA to represent all of the codons needed to correctly translate the protein. 50 O 100 147 150 153
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
What role does mRNA play in the process of protein synthesis? Choose all that apply. Select one or more: Every three nucleotides binds an amino acid It opens up the DNA strand for transcription to occur ] c. It is a template for the arrangement of tRNAS 1 d. It determines the order in which amino acids are added to the growing protein e. It copies DNA to be used in later steps
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
aus: 99 Consider the following DNA sequence: TTAGATCGTAAAGTGCAATGGGATCATATG What would be the mRNA transcribed from this DNA sequence? ots)? 10 AAU CUA G CA unU CAC Gui ACC CUA GUAU- How many codons does the sequence contain 21 th A How many amino acids make up this protein? (1 pt) List the amino acids, in order, that make up this protein using the chart provided. (5 pts) Referring to the mRNA strand constructed in Question #3, list the tRNA anti-codons...
Most questions answered within 3 hours.
-
10. Complete the table below
only using hexadecimal numbers:
AL CODE
EBX
EAX
[EAX]
mov eax,...
asked 38 seconds ago -
trust is best established through the combination of ------and
------- .
1. magnanimity and justice
2....
asked 15 minutes ago -
Blood pressure is normally taken on the upper arm at the level
of the heart. Suppose,...
asked 14 minutes ago -
Suppose that the satellite around the earth has an orbit that is
24 KM larger in...
asked 17 minutes ago -
Calculate the [OH (aq)] in limes which have a [H3O*(aq)] of 1.3 x
10 mol/L
asked 15 minutes ago -
A nozzle with a radius of 0.250 cm is attached to a garden hose
with a...
asked 26 minutes ago -
PLEASE do not use any loops for the program; only recursion is
allowed
4. Write a...
asked 35 minutes ago -
Please help me with me. I did the first part to write the operations but in...
asked 32 minutes ago -
Use Cryptool to find the Cryptographic SHA-1 hash value of the
string "abc". The calculator is...
asked 37 minutes ago -
You are attempting to calculate a firm’s free cash flow to
equity. You know the following...
asked 1 hour ago -
the following reaction occurs in a balloon containing
N2O2 gas
N2O4(g)=2NO2(g)
will the volume of the...
asked 2 hours ago -
answer the questions throughout this program
public class Day implements Comparable {
Private Boolean atWork;...
asked 2 hours ago