We can use CpG islands to detect the functional gene in related organisms using DNA sequences.
One characteristic shared by ∼50% of mammalian promoters is the occurrence of CpG islands located near the 5’ ends of genes. We can therefore searched the entire human and mouse gene clusters for CpG islands using the CpG plot program.
Detection of regions of genomic sequences that are rich in the CpG pattern is important because such regions are resistant to methylation and tend to be associated with genes which are frequently switched on. Regions rich in the CpG pattern are known as CpG islands. The function of the program CpG Plot is to plot CpG rich areas, and CpG Report to report all CpG rich regions.
Question 1 10 pts Explain how you would use DNA sequence data from two related organisms...
Mutations arc changes in the DNA sequence of organisms and are the primary source of variation in populations. Brainstorm with your group mates some known mutations in the human population (some examples are provided): Of the mutations listed above, which ones do you predict to affect the "fitness" (ability to reproduce) of the individual? How (is it beneficial or detrimental)? Of the mutations listed above, which ones do you predict to affect the "fitness" (ability to reproduce) of the population?...
Question 38 1 pts What is the sequence of RNA that would be made from the following segment of a gene? DNA 5 TTACGCATGGCA 3 O AAUGCGUACCGU O AATGCGTACCGT O UGCCAUGCGUAA. OTGCCATAGCGTAA
8) You have extracted DNA from two different organisms. In the purification process, you find that the two test tubes have lost their identifying labels. The sequences of DNA are: Sample 1: TCC CTA TGC CCG AGG GAT ACG GGC Sample 2: CGA TCT TAA CCC GCT AGA ATT GGG The only other piece of information you have is the corresponding amino acid sequence of a particular protein for both organisms. Organism I has ala-arg-ile-gly and organism II has ala-arg-ile-pro....
8) You have extracted DNA from two different organisms. In the purification process, you find that the two test tubes have lost their identifying labels. The sequences of DNA are: Sample 1: TCC CTA TGC CCG ///// AGG GAT ACG GGC Sample 2: CGA TCT TAA CCC ///// GCT AGA ATT GGG The only other piece of information you have is the corresponding amino acid sequence of a particular protein for both organisms. Organism I has ala-arg-ile-gly and organism II...
You are studying the regulatory DNA of a mouse gene expressed in developing heart, liver, and lung tissue. Your preliminary work has shown that heart and lung expression of this gene is controlled by a short fragment of DNA just upstream of the promoter. Based on this result, you decide to investigate this region further to understand its function. Part A You decide to compare this sequence to the regulatory DNA of the same gene found in rats and humans....
BTH2732 Recombinant DNA Technology For answer all questions below part, Ignore question 1. Just do question 2 and below Part A: Refer to Lecture 3 & Supplementary Video: https://www.youtube.com/watch?v SiwNtQYLKeU Virtual cloning of the Human p53 gene You are required to devise a set of practical methodologies in order to carry out a relatively simple molecular biology task. 1. You must identify the steps required 2. Formulate a set of practical protocols needed to carry out those steps . Consider...
10 pts Question 15 (TCO 6) How many select lines are required for a 1-to-32 multiplexer? Explain how you determined your answer HTML Editor Paragraph
Thanks!! 1 pts D Question 2 Explain how the bacterium is attenuated in the Vivotif vaccine and why this attenuation prevents the the bacteria in the vaccine from causing typhoid fever. (Note: You will find the answer in the product insert for the drug under "Clinical Pharmacology." Be specific and thorough in your response.) HTML Editor? ? , Paragraph o words
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce the mRNA sequence indicated below (Questions 13-15). cted to 5- UCUUAGGAGGUAUCCAUGUCCGGUACUGCGAGAGGUAGUUAAGCC3 Shine-Dalgarno motif Site of insertion for question 14 13) Predict the amino acid sequence of the peptide produced from this mRNA (use the 3-letter abbreviation for amino acid names; e.g. ILE for isoleucine, ALA for alanine. Look it up online if you can't find it in one of your biology books). 14) What...
1) Using the bacterial DNA sequence that the instructor gave you:a. Identify and underline the promoter region and the start codon.b. Identify the coding and template strandc. Transcribe the coding sequenced. Translate the mRNA sequence8) Which of the following mutational changes would you predict to be the most deleterious to gene function? Explain your answers.a. Insertion of a single nucleotide near the end of the coding sequence.b. Removal of a single nucleotide near the beginning of the coding sequence.c. Deletion...