Question

8) You have extracted DNA from two different organisms. In the purification process, you find that...

8) You have extracted DNA from two different organisms. In the purification process, you find that the two test tubes have lost their identifying labels. The sequences of DNA are:

Sample 1: TCC CTA TGC CCG ///// AGG GAT ACG GGC

Sample 2: CGA TCT TAA CCC ///// GCT AGA ATT GGG

The only other piece of information you have is the corresponding amino acid sequence of a particular protein for both organisms. Organism I has ala-arg-ile-gly and organism II has ala-arg-ile-pro.

a) What amino acid sequence corresponds with which nucleic acid sequence?

b) For each sample of DNA, which is the sense strand?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

(a)

Sample I with sequence 5'-gcc cgt atc cct-3' codes for "ala-arg-ile-pro". Hence sample I belongs to organism II.

Sample II with sequence 5'-GCT AGA ATT GGG-3' codes for "ala-arg-ile-gly". Hence sample II belongs to organism I.

(b) Sense strands are

3'-TCC CTA TGC CCG-5' (sample I).

5'-GCT AGA ATT GGG-3' (sample II).

Add a comment
Know the answer?
Add Answer to:
8) You have extracted DNA from two different organisms. In the purification process, you find that...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 8) You have extracted DNA from two different organisms. In the purification process, you find that...

    8) You have extracted DNA from two different organisms. In the purification process, you find that the two test tubes have lost their identifying labels. The sequences of DNA are: Sample 1: TCC CTA TGC CCG AGG GAT ACG GGC Sample 2: CGA TCT TAA CCC GCT AGA ATT GGG The only other piece of information you have is the corresponding amino acid sequence of a particular protein for both organisms. Organism I has ala-arg-ile-gly and organism II has ala-arg-ile-pro....

  • Please develop a Java program to read in a piece of DNA sequence from a FASTA format sequence fil...

    Please develop a Java program to read in a piece of DNA sequence from a FASTA format sequence file (alternatively you can use the getRandomSeq(long) method of the RandomSeq class to generate a piece of DNA sequence), and then print out all the codons in three forward reading frames. Design a method called codon() that can be used to find all the codons from three reading frames. The method will take in an argument, the reading frame (1, 2, or...

  • Adenosine deaminases modify adenosines to form _____________________, which is then read as _________________________ by the translation...

    Adenosine deaminases modify adenosines to form _____________________, which is then read as _________________________ by the translation and splicing systems, as well as by reverse transcriptase. Cephalopods like squid and octopus use this form of editing very extensively in their protein-coding regions.  For each of the following, please indicate how these enzymes can alter the mRNA to produce the indicated codon changes.   I (Ileu)  is changed to V (val): K (Lys) is changed to E (Glu): T (Thr) is changed to A (ala):...

  • mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui...

    mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui ead in onder to. start and stop mak Land when to stot C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop Follow example below Example: DNA AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC UCU GCC...

  • 15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...

    15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...

  • The next DNA sequence is the MATRICE strand of a small gene. What is the complete...

    The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...

  • The DNA sequence shown encodes the last amino acids of a protein that has a total...

    The DNA sequence shown encodes the last amino acids of a protein that has a total of 270 amino acids. The bolded base pairs indicate the translation reading frame. 5’ …….GCT AAG TAT TGC TCA AGA TTA GGA TGA TAA ATA ACT TGG 3’ 3’ …….CGA TTA ATA ACG AGT TCT AAT CCT ACT ATT TAT TGA ACC 5’ Which is the template strand for transcription? Explain.

  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

  • The following genomic DNA sequence comes from the first exon of a human gene and contains...

    The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...

  • you are informed that CGATCA codes for an intron UUU)phe UCU UAU TVE UUC) Pne UCC...

    you are informed that CGATCA codes for an intron UUU)phe UCU UAU TVE UUC) Pne UCC Ser UAC 'yr UUA UCA Ser UUG Leu UCG) UGUve UGC Cys UAA Stop UGA Stop UAG Stop UGG Trp CGU) CGC CCU CUU CUC CCC Pro CAC His CỦA Leu CCA CCG) CAAGI CGA Arg CUG) CAGS CGG First letter DOC DOC DOC Doco Third letter AAU Asn AGU Ser AGC Se AAA Lys AGA Arg AAG AGG/Arg AUU ACU AUC lle ACC...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT