Direction of translation of cDNA, mRNA and the corresponding direction of the translated protein.
- Direction of translation of cDNA, mRNA and the corresponding direction of the translated protein.
Homework Answers
Complementary DNA (cDNA) is synthesised by reverse transcriptase enzyme by using an RNA molecule(mRNA in most cases) as a template. The template RNA's 3' end is primed and the polymerisation happens in a 5'-->3' direction for the cDNA(complementing the template RNA's direction).
In the case of mRNA, the template DNA is unwound and one strand of that DNA(polarity 3'-5') is chosen by DNA dependent RNA polymerase to make new RNA stand in 5'-->3' polarity.
For a protein to be synthesised during the translation process, the translation machinery uses 5'-->3' polarity of mRNA to read the codons and add aminoacids in the corresponding(N--C terminal) direction.
Add Answer to:
Direction of translation of cDNA, mRNA and the corresponding
direction of the translated protein.
Which of the following can be translated into protein? A. rRNA B. tRNA C. mRNA D....
Which of the following can be translated into protein? A. rRNA B. tRNA C. mRNA D. miRNA E. B and C
An mRNA is translated into a protein in a cell-free extract in the absence of presence...
An mRNA is translated into a protein in a cell-free extract in the absence of presence of microsomes or endoplasmic reticulum. Samples are treated as follows: (I) no treatment, (II) addition of protease, (IIl) addition of protease and detergent, and (IV) disruption of mircosomes and addition of endoH, an enzyme removing N-linked sugars that are added in the ER. Analysis by gel electrophoresis is shown in the figure. 7. MICROSOMESİ MICROSOMES ABSENT PRESENT TREATMENT protease a. Proteih synthesis at the...
Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript...
Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript containing 1200 bases, which is translated into a protein containing 300 amino acids. A. How long is the coding sequence in this mRNA and how many nucleotides are in the UTRs? For the purposes of this question we are ignoring the G’ cap and the polyA tail. B. A mutant form of the gene created by one nucleotide being changed to another nucleotide also...
Describe the steps (Initiation, Elongation and Termination) involved in translation of mRNA to generate a protein,...
Describe the steps (Initiation, Elongation and Termination) involved in translation of mRNA to generate a protein, including the all the important molecules involved and how they interact. Diagrams MUST be included in your answer. (Draw on some paper, then photograph and insert the drawing below.) You may add to your answer using bullet points if you find it easier, but make sure they are in the correct order!
describe the difference in ribosome function between bacteria mrna translation and eukaryotes mRNA translation?
describe the difference in ribosome function between bacteria mrna translation and eukaryotes mRNA translation?
Which of the following accurately describes the production of cDNA? O First, mRNA is Isolated from...
Which of the following accurately describes the production of cDNA? O First, mRNA is Isolated from cells. Then, with the help of reverse transcriptase and nucleotides with fluorescent probes attached, the mRNA is used to produce single-stranded cDNA complementary to the mRNA. Reverse transcriptase and nucleotides with fluorescent probes attached spontaneously produce cDNA First, miRNA is isolated from cells. Then, reverse transcriptase is used to isolate cDNA nucleotides from the tส rget genes. O O Single-stranded cDNA is easily isolated...
Fbx25 is transcribed and processed in the nucleus and translated in the cytoplasm. Thus, the mRNA...
Fbx25 is transcribed and processed in the nucleus and translated in the cytoplasm. Thus, the mRNA must leave the nucleus using the G-protein Ran. Which of the following is true of G-proteins? They are active when bound to GTP They are active when bound to GDP. They actively synthesize GTP from GDP and phosphate They are activated by GAPs and deactivated by GEFs
Transcribe the following DNA sequence into mRNA, and then translate it into protein. Be sure to...
Transcribe the following DNA sequence into mRNA, and then translate it into protein. Be sure to figure out where translation would start, and where it would stop. DNA GGCTATACCGGTTACCGATAATTGGCTATCTG RNA: Protein:
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
List the steps involved in the transcription and translation of DNA into mRNA and tRNA in order? DNA replicated to RNA t...
List the steps involved in the transcription and translation of DNA into mRNA and tRNA in order? DNA replicated to RNA tRNA translates mRNA and adds amino acids to the growing peptide chain making a protein mRNA leaves nucleus Introns are excised from hnRNA Addition of 5' cap and poly-A tail to mRNA
An mRNA is translated into a protein in a cell-free extract in the absence of presence of microsomes or endoplasmic reticulum. Samples are treated as follows: (I) no treatment, (II) addition of protease, (IIl) addition of protease and detergent, and (IV) disruption of mircosomes and addition of endoH, an enzyme removing N-linked sugars that are added in the ER. Analysis by gel electrophoresis is shown in the figure. 7. MICROSOMESİ MICROSOMES ABSENT PRESENT TREATMENT protease a. Proteih synthesis at the...
Which of the following accurately describes the production of cDNA? O First, mRNA is Isolated from cells. Then, with the help of reverse transcriptase and nucleotides with fluorescent probes attached, the mRNA is used to produce single-stranded cDNA complementary to the mRNA. Reverse transcriptase and nucleotides with fluorescent probes attached spontaneously produce cDNA First, miRNA is isolated from cells. Then, reverse transcriptase is used to isolate cDNA nucleotides from the tส rget genes. O O Single-stranded cDNA is easily isolated...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
Most questions answered within 3 hours.
-
Jesse’s Machining is looking to buy a new machine to handle a
new four-year contract for...
asked 4 minutes ago -
5. A slide mount of a fungal specimen is prepared. A slide and
coverslip are flame-sterilized....
asked 6 minutes ago -
A parallel plate capacitor has a charge Q, plates of area A and
separation d, where...
asked 9 minutes ago -
This question goes along with my test results for a psychology
seminar. The results were the...
asked 10 minutes ago -
A calorimeter contains 35.0 mL of water at 13.0 ∘C . When 1.40 g
of X...
asked 14 minutes ago -
[The following information applies to the questions
displayed below.]
Arndt, Inc. reported the following for 2021...
asked 15 minutes ago -
Equivalent Units of Conversion Costs
The Rolling Department of Kraus Steel Company had 2,370 tons in...
asked 21 minutes ago -
Genetic differences between closely related species are due to
changes at both synonymous and nonsynonymous sites...
asked 27 minutes ago -
Assignment:
Implement an 8 bit register in VHDL/Verilog using Model Sim
software. Show two test cases...
asked 32 minutes ago -
Think about the published number of fatalities in the
September 11th disaster in New York. Why...
asked 29 minutes ago -
Suppose you are very allergic to peanuts or even grass, and you
go into anaphylactic shock....
asked 31 minutes ago -
The governor has proposed to clean up all the trash on the side
of the highway....
asked 46 minutes ago