Trypsin is an enzyme that cleaves on the C-terminal side (that is, to the right of)...
Trypsin is an enzyme that cleaves on the C-terminal side (that
is, to the right of) all basic residues. Consider the peptide shown
below. Predict the fragments that would be formed by treatment of
this peptide with trypsin:
N terminal end-Leu-Lys-Asn-Asp-Thr-His-Val-Met-Cys
Homework Answers
Add Answer to:
Trypsin is an enzyme that cleaves on the C-terminal side (that
is, to the right of)...
5. Consider the following peptide: His-Ser-Gln-Gly-Thr-Phe-Thr-Ser-Asp-Tyr-Ser-Lys-Tyr-Leu-Asp-Ser-Arg-Arg-Ala-Gin- Asp-Phe-Val-Gln-Trp-Leu-Met-Asn-Thr a. What are the fragments, if it is cleaved...
5. Consider the following peptide: His-Ser-Gln-Gly-Thr-Phe-Thr-Ser-Asp-Tyr-Ser-Lys-Tyr-Leu-Asp-Ser-Arg-Arg-Ala-Gin- Asp-Phe-Val-Gln-Trp-Leu-Met-Asn-Thr a. What are the fragments, if it is cleaved by trypsin? b. What are the fragments, if it is cleaved by chymotrypsin? c. What are the fragments, if it is cleaved by pepsin?
please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A...
please explain how to solve this problem, the answer
is provided
9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
On your internship, you visit the Mass Spectrometry Lab. Mass spectrometry can identify short peptide fragments...
On your internship, you visit the Mass Spectrometry Lab. Mass spectrometry can identify short peptide fragments based on their molecular weights. Your fellow intern Jerry has neglected to label his tubes of amyloid beta peptide 42 after digesting them with some proteases that we learned about in Module 6: pepsin, trypsin, and chymotrypsin. Help him figure out what protease is in each tube. Jerry’s supervisor has the fragments listed in the same order as the original peptide primary sequence, which...
PLEASE HELP OCHEM QUESTION 1. In the following protein, identify the type of bonding or interaction...
PLEASE HELP OCHEM QUESTION
1. In the following protein, identify the type of bonding or interaction that is responsible for holding the two peptide chains together at each amino acid pair, above (A) and below (B). Gly - Ala - Ser - Cys - Val - Asp - Leu - Thr - His - Ile-Tyr-Glu - Phe - Lys - Cys - Met - Asn Val - Leu -Gin-Cys - Pro-Lys - Met - Tyr - Asp -Phe-Asn-Lys - Ile...
Thrombin is an enzyme seen in the blood clotting cascade. It cleaves proteins on the carboxyl...
Thrombin is an enzyme seen in the blood clotting cascade. It cleaves proteins on the carboxyl side of arginine residues. How many peptide fragments would be formed if Thr-Phe-Arg-Lys-His-Pro-Arg was treated with thrombin? 3 Thrombin would not cleave this polypeptide, since there are no arginine residues. O 1 0 2
Thermolysin cuts on the N-terminal side of valine, isoleucine, leucine and phenylalanine. Write down the fragments...
Thermolysin cuts on the N-terminal side of valine, isoleucine, leucine and phenylalanine. Write down the fragments formed of following polypeptide treated with this enzyme. Ala-Leu-Cys-Tyr-His-Arg-Val-Gly = ?? Chymotryspin cuts on the C-terminal side of phenylalanine, tryptophan and tyrosine. Write down the fragments formed of following polypeptide treated with this enzyme. Ala-Leu-Cys-Tyr-His-Arg-Val-Gly = ??
Question 13 of 19 > Suppose Kara has isolated a peptide and must determine the amino...
Question 13 of 19 > Suppose Kara has isolated a peptide and must determine the amino acid sequence. After one cycle of Edman degradation on a sample of the peptide, she produces a phenylthiohydantoin (PTH) derivative, OH Treatment with cyanogen bromide on another sample of her peptide gives her the fragments • Lys-Pro-Ala-Met, • Pro-Asp. • Leu-Ile-Cys-Trp-Met, and • Thr-Arg.Met. She also digested a sample of her peptide with the enzyme chymotrpsin. One of the fragments produced after treatment with...
What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on y...
What two restriction enzymes could you use if you wanted to
produce a protein that was fused to a GST-tag that could be removed
using thrombin? Would this experimental design place any other tags
on your protein?
Here is the vector:
T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
S Review View It, lea .--. . rrnalI1No Spac Heading 1 Heading 2 Title Subtitle Subtle Ern Emphas ...
s Review View It, lea .--. . rrnalI1No Spac Heading 1 Heading 2 Title Subtitle Subtle Ern Emphas Paragraph Styles 1. Explain how you would isolate a mixture of Ala-Arg-Glu using a negatively charged resin (carboxylmethyl cellulose) and a positively charged resin (DEAE). A sample of a peptide of unknown sequence was treated with trypsin; another sample of the same peptide was treated with chymotrypsin. The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were 2....
5. Consider the following peptide: His-Ser-Gln-Gly-Thr-Phe-Thr-Ser-Asp-Tyr-Ser-Lys-Tyr-Leu-Asp-Ser-Arg-Arg-Ala-Gin- Asp-Phe-Val-Gln-Trp-Leu-Met-Asn-Thr a. What are the fragments, if it is cleaved by trypsin? b. What are the fragments, if it is cleaved by chymotrypsin? c. What are the fragments, if it is cleaved by pepsin?
please explain how to solve this problem, the answer
is provided
9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
PLEASE HELP OCHEM QUESTION
1. In the following protein, identify the type of bonding or interaction that is responsible for holding the two peptide chains together at each amino acid pair, above (A) and below (B). Gly - Ala - Ser - Cys - Val - Asp - Leu - Thr - His - Ile-Tyr-Glu - Phe - Lys - Cys - Met - Asn Val - Leu -Gin-Cys - Pro-Lys - Met - Tyr - Asp -Phe-Asn-Lys - Ile...
Thrombin is an enzyme seen in the blood clotting cascade. It cleaves proteins on the carboxyl side of arginine residues. How many peptide fragments would be formed if Thr-Phe-Arg-Lys-His-Pro-Arg was treated with thrombin? 3 Thrombin would not cleave this polypeptide, since there are no arginine residues. O 1 0 2
Question 13 of 19 > Suppose Kara has isolated a peptide and must determine the amino acid sequence. After one cycle of Edman degradation on a sample of the peptide, she produces a phenylthiohydantoin (PTH) derivative, OH Treatment with cyanogen bromide on another sample of her peptide gives her the fragments • Lys-Pro-Ala-Met, • Pro-Asp. • Leu-Ile-Cys-Trp-Met, and • Thr-Arg.Met. She also digested a sample of her peptide with the enzyme chymotrpsin. One of the fragments produced after treatment with...
What two restriction enzymes could you use if you wanted to
produce a protein that was fused to a GST-tag that could be removed
using thrombin? Would this experimental design place any other tags
on your protein?
Here is the vector:
T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
s Review View It, lea .--. . rrnalI1No Spac Heading 1 Heading 2 Title Subtitle Subtle Ern Emphas Paragraph Styles 1. Explain how you would isolate a mixture of Ala-Arg-Glu using a negatively charged resin (carboxylmethyl cellulose) and a positively charged resin (DEAE). A sample of a peptide of unknown sequence was treated with trypsin; another sample of the same peptide was treated with chymotrypsin. The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were 2....
Most questions answered within 3 hours.
-
5. You are a quality control engineer and you are
asked to analyze the lifetime (in hours)...
asked 6 minutes ago -
How many ways can 2 people be chosen and arranged in a straight
line if there...
asked 59 minutes ago -
(Problem 1d). Leandro has 16 hours per day that he can allocate
to work or leisure....
asked 1 hour ago -
Morganton Company
makes one product and it provided the following information to help
prepare the master...
asked 2 hours ago -
2Al + 3Cl2 --> 2AlCl3
If one mole Al is reacted w two moles Cl2, how...
asked 2 hours ago -
1. You will see some trends in the movement of each currency vs.
the US Dollar....
asked 2 hours ago -
9. (9 pts) An investor with a stock portfolio worth several
hundred thousand dollars sued his...
asked 3 hours ago -
Which statement is true?
a. Unless directed otherwise, the computer automatically
executes C. statements one before...
asked 3 hours ago -
When a new company is considering Speed to Market for a product
launch, which would provide...
asked 4 hours ago -
bacteria and their metabolites could either promote or protect from
cancer. Explain one of these cases...
asked 4 hours ago -
Use the sample data and confidence level given below to complete
parts (a) through (d).
A...
asked 5 hours ago -
During laser vision correction, a brief burst of 193 nm
ultraviolet light is projected onto the...
asked 5 hours ago