Dont't copy please answer all parts of this question and explain everything please. thank you 7)...
Dont't copy please answer all parts of this question and explain everything please. thank you
7) You isolate a mutant strain of mice that grow at an unusually fast rate, perform a blood test on the mice, and find that they have elevated levels of insulin-like growth factor2. The phenotype is the result of a mutation in a region of the genome containing a gene encoding a DNA methylase. What kind of mutation is causing the rapid growth of these mice?
Homework Answers
Add Answer to:
Dont't copy please answer all parts of this question and explain
everything please. thank you
7)...
Please answer both parts a and b. Please explain your answer. (The marked answers in the...
Please answer both parts a and b. Please explain your answer.
(The marked answers in the pictures are incorrect!)
a)
b)
What are the 5 base pair primer sequences required to amplify the central region of the following template, such that the final PCR product will have a length of 20 nucleotides? 3' AGCTTGTCCAGTGGTCAGAGTCAGTAGCCGTAGG 5' Select one: O a. 5' CCAGT 3' and 5'CTACT 3' b. 5' GATGA 3' and 5' GGTCA 3' O O C.5'GAACA 3' and 5' ATGCC...
2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving...
2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...
please answer all the questions Question 8 0 / 1 pts Our understanding of RNA ...
please answer all the questions
Question 8
0 / 1 pts
Our understanding of RNA
was non-existent until 2000
started with the identification of a tRNA which suggested a
method of converting DNA to protein
began to identify that DNA-->protein--> RNA
stopped growing after it's original discovery in the 70s
IncorrectQuestion 10
0 / 1 pts
Enzymes allow for chemical reactions to occur in the cell that
may not naturally occur at the right place at...
You have a P-element induced mutation that is homozygous lethal. You think that the element might...
You have a P-element induced mutation that is homozygous lethal. You think that the element might be inserted into the DMAP1 gene. Which of the following techniques can be used to confirm (or not) that DMAP 1 is the gene responsible for the lethality? Rescue using the DMAP1 cDNA ORNAi for DMAP1 Obtain a large deletion on the chromosome and test for failure to complement two of these all of these White eyed flies can be generated in several different...
Please answer 2-5 2. Consider a gene with a particular function. Mutation X and mutation Y...
Please answer 2-5
2. Consider a gene with a particular function. Mutation X and mutation Y cach cause defects in the function of the encoded protein, yet a gene containing both mutations X and Y encodes a protein that works even better than the original protein. The odds are exceedingly small that a single mutational event will generate both mutations X and Y. Explain a simple way that an organism with a mutant gene containing both mutations X and Y...
Please answer the below genetics question and show/explain all work. 4. You've recently discovered the sequences...
Please answer the below genetics question and show/explain all
work.
4. You've recently discovered the sequences for two alleles for the mouse gene XCD, which you have creatively named XCD and XCD2. This gene is believed to be involved in fat metabolism, somehow, but you haven't successfully been able to isolate the protein yet. You've also noticed that your mutant grey coat mice tend to be much leaner and muscular than those with the standard white coat. So for your...
Please answer all.... Thank you! 81)If a polypeptide chain contains 600 amino acids, then the gene...
Please answer all.... Thank you!
81)If a polypeptide chain contains 600 amino acids, then the
gene coding for this polypeptide must contain _____.
600 nucleotides
1200 nucleotides
1800 nucleotides
1800 codons
1800 anticodons
More than one of the above are correct.
82) When we altered gene triplet in the DNA produces a chain-terminating codon in the mRNA, the (1pts) result is called a reverse mutation nonsense mutation missense mutation spontaneous mutation frameshift mutation 83) A single base substitution changes the...
can you please answer all the questions Gene therapy can best be described as the OA....
can you please answer all the questions
Gene therapy can best be described as the OA. repair of a defect (mutation) in a gene B. insertion of normal genes to act in place of mutant genes Oc. insertion of human genes into other organisms D. cloning of genes to produce and purify therapeutically useful proteins E. mapping of all human genetic information Donot Selection Transmission genetics A. uses recombinant DNA technology to identify, isolate, and produce millions of copies of...
please help me with this genetics question! thank you! TS =Tumor Suppressor genes O = Oncogenes...
please help me with this genetics question! thank you!
TS =Tumor Suppressor genes
O = Oncogenes
5A. (12pts) Cancer is a genetic disease. Some of the causative mutations are Tumor Suppressor genes, and others convert proto-oncogenes into Oncogenes. In the list of properties below, mark an X in the column for TS, O, or both. TS O both Causes of inherited elevated cancer risk. Leads to uncontrolled cell growth. Typically, spontaneous, gain-of-function mutations. Can cause increased DNA damage. Dominant in...
NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS WELL. THANKSSSSSSS 1. You want...
NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS
WELL. THANKSSSSSSS
1. You want to clone a gene from a donor vector to a host vector. List the correct order of events in the process of cloning a. Perform ligation reaction of cloned gene and host vector. b. Perform double digestion of both donor and host vectors with the 2 restriction enzymes c. Examine donor and host vectors for restriction sites d. Purify cloned gene from donor vector...
Please answer both parts a and b. Please explain your answer.
(The marked answers in the pictures are incorrect!)
a)
b)
What are the 5 base pair primer sequences required to amplify the central region of the following template, such that the final PCR product will have a length of 20 nucleotides? 3' AGCTTGTCCAGTGGTCAGAGTCAGTAGCCGTAGG 5' Select one: O a. 5' CCAGT 3' and 5'CTACT 3' b. 5' GATGA 3' and 5' GGTCA 3' O O C.5'GAACA 3' and 5' ATGCC...
please answer all the questions
Question 8
0 / 1 pts
Our understanding of RNA
was non-existent until 2000
started with the identification of a tRNA which suggested a
method of converting DNA to protein
began to identify that DNA-->protein--> RNA
stopped growing after it's original discovery in the 70s
IncorrectQuestion 10
0 / 1 pts
Enzymes allow for chemical reactions to occur in the cell that
may not naturally occur at the right place at...
You have a P-element induced mutation that is homozygous lethal. You think that the element might be inserted into the DMAP1 gene. Which of the following techniques can be used to confirm (or not) that DMAP 1 is the gene responsible for the lethality? Rescue using the DMAP1 cDNA ORNAi for DMAP1 Obtain a large deletion on the chromosome and test for failure to complement two of these all of these White eyed flies can be generated in several different...
Please answer 2-5
2. Consider a gene with a particular function. Mutation X and mutation Y cach cause defects in the function of the encoded protein, yet a gene containing both mutations X and Y encodes a protein that works even better than the original protein. The odds are exceedingly small that a single mutational event will generate both mutations X and Y. Explain a simple way that an organism with a mutant gene containing both mutations X and Y...
Please answer the below genetics question and show/explain all
work.
4. You've recently discovered the sequences for two alleles for the mouse gene XCD, which you have creatively named XCD and XCD2. This gene is believed to be involved in fat metabolism, somehow, but you haven't successfully been able to isolate the protein yet. You've also noticed that your mutant grey coat mice tend to be much leaner and muscular than those with the standard white coat. So for your...
Please answer all.... Thank you!
81)If a polypeptide chain contains 600 amino acids, then the
gene coding for this polypeptide must contain _____.
600 nucleotides
1200 nucleotides
1800 nucleotides
1800 codons
1800 anticodons
More than one of the above are correct.
82) When we altered gene triplet in the DNA produces a chain-terminating codon in the mRNA, the (1pts) result is called a reverse mutation nonsense mutation missense mutation spontaneous mutation frameshift mutation 83) A single base substitution changes the...
can you please answer all the questions
Gene therapy can best be described as the OA. repair of a defect (mutation) in a gene B. insertion of normal genes to act in place of mutant genes Oc. insertion of human genes into other organisms D. cloning of genes to produce and purify therapeutically useful proteins E. mapping of all human genetic information Donot Selection Transmission genetics A. uses recombinant DNA technology to identify, isolate, and produce millions of copies of...
please help me with this genetics question! thank you!
TS =Tumor Suppressor genes
O = Oncogenes
5A. (12pts) Cancer is a genetic disease. Some of the causative mutations are Tumor Suppressor genes, and others convert proto-oncogenes into Oncogenes. In the list of properties below, mark an X in the column for TS, O, or both. TS O both Causes of inherited elevated cancer risk. Leads to uncontrolled cell growth. Typically, spontaneous, gain-of-function mutations. Can cause increased DNA damage. Dominant in...
NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS
WELL. THANKSSSSSSS
1. You want to clone a gene from a donor vector to a host vector. List the correct order of events in the process of cloning a. Perform ligation reaction of cloned gene and host vector. b. Perform double digestion of both donor and host vectors with the 2 restriction enzymes c. Examine donor and host vectors for restriction sites d. Purify cloned gene from donor vector...
Most questions answered within 3 hours.
-
. Determine the hourly multiplication factors
such that the total daily water consumption will equal 15,000...
asked 58 seconds ago -
A budgeting Web site reported that 35% of U.S. households have
withdrawn money from a 401(k)...
asked 18 seconds from now -
In this assignment, you will write a minimum two-page paper that
explains the treatment of internal...
asked 4 minutes ago -
Direct marketing is also referred to as Question 50 options: 1)
one-to-one marketing. 2) business-customer marketing....
asked 7 minutes ago -
INK Ltd is grocery retailer with 103 shops around South
Australia and Tasmania. The company has...
asked 12 minutes ago -
HOW BEER IS MADE
The beer making process is an art. It takes time, patience and...
asked 13 minutes ago -
What two methods could be used to purify the dimethyl
fumarate?
Based on the 12 Principles...
asked 22 minutes ago -
Reflect upon the readings and videos as well as our Media Monday
discussion. Integrating concepts from...
asked 27 minutes ago -
1. A cylindrical capacitor with A = 0.01, B = 0.1 and a length
of 5...
asked 34 minutes ago -
Explain how taking an SGLT-2 inhibitor, along with taking
insulin leads to ketoacidosis in people who...
asked 43 minutes ago -
Show the truth table of the
gates needed to control the PISO internal FF, has a...
asked 46 minutes ago -
If X ~ N(50; 100); Determine the value of '' k '' for both
situation:
a)...
asked 1 hour ago